Fertilization and Evolution of Plants

Project description-Project proposals

1. Literature review

1.1. Evolution of plants from the reproductive point of view

The first evidence of plants on the earth is observed in fossils of unicellular photosynthetic organisms that divided by mitosis (Charlesworth 1991). In more recent sediments of rock in southern Ontario, Canada, early prokaryotes in the form of blue-green algae were also found. Based on geological evidence, the reorganization of continental plates on earth, has led to dramatic changes in sea level, and this was accompanied by the evolution of green algae into more sophisticated multicellular plants at the end of the Cambrian, for example by exploiting biochemical pathways developed in cyanobacteria that enabled respiration and photosynthesis (Bateman et al. 1998).

Parallel to changes in the environment, plants began to develop mechanisms to spread their spores (gametes) through water, and with the colonization of land plants developed mechanisms to produce and spread spores in dry environments. The first spores identified in the Ordovician era had a tetrahedron arrangement while others from younger sediments are found as isolated spores with a distinct trilete form (Fig. 1). These structures provide strong evidence for meiotic division whereby a diploid cell produces four haploid cells (Pennington 2002).

Fig.1.Spores arranged tetrahedron form(a);composition of tetraheron of spores(b,c) (Pennington 2002)

Furthermore one of the earliest evidence of sexual reproduction was found in the fossil specimen of Isochadites (Codiaceae), which show gametocytes with reproductive structures. Later on angiosperms diverged with respect to the generation of seed producing fetuses  in the Jurassic era (Crane et al. 1995),and this was characterized by the emergence of the carpel followed by the occurrence of double fertilization. Hypotheses suggests that only after these two evolutionary steps occurred were mutations responsible for the appearance of the floral component derived(Raghavan 2006).

1.2. Universality of double fertilization in flowering plants

Seed development in flowering plants occurs through a few steps. First, the transition from the vegetative to reproductive phase occurs by formation of floral organs. After ovule and stamen formation, meiosis and gametogenesis occur in the ovules of the carpels and anthers of the stamen. Female gametes are produced from megaspore mother cells during mega-sporogenesis, whereby the functional megaspore undergoes three mitotic divisions to give rise to a syncytium containing eight nuclei including antipodals, synergids, egg, and polar nucleus. In a phenomenon known as double fertilization(fig.2), a pollen with two sperm cells fertilizes the egg cell to form the diploid embryo, and the binucleate central cell to produce the triploid endosperm, the primarily energy source of the growing embryo. After fertilization, the ovule develops into the seed which becomes the fruit (Tucker & Koltunow 2009).

Fig.2. Double fertilization. a Mature embryo sac showing the egg apparatus, consisting of the egg and synergids, antipodals, upper polar nucleus, and lower polar nucleus. b Mature embryo sac after discharge of male gametes from the pollen tube. The nucleus one of sperm has entered the egg and that of the second sperm is in contact with the upper polar nucleus. c Union of one sperm with the egg nucleus and of the second sperm with the two polar nuclei. an Antipodals, e egg cell, lp lower polar nucleus, pt pollen tube, s1 sperm that fuses with the egg, s2 sperm that fuses with the polar nucleus, sy synergid, up upper polar nucleus(drawn from Raghavan, 2006).

1.2.1. Double fertilization and the control of embryo initiation

The embryo and endosperm in a seed are derived from the egg cell and central cell of embryo sac, respectively. Accessory cells in the embryo sac play an important role in the double fertilization process. The synergids guide the pollen tube through the micropyle into the embryo sac by producing pollen tube attractant (Higashiyama et al. 2001). For instance, in Torenia Fournieri, the pollen tube is attracted to the embryo sac in vitro, suggesting that synergids produce diffusible signals, and at least one synergid cell is necessary for pollen tube attraction. The pollen tube penetrates the degenerating synergid and after that releases two sperm cells.

Double fertilization was first identified as a ubiquitous feature in the reproductive biology of flowering plants in the nineteenth century. The discovery of double fertilization in liliaceous species, followed by confirmation of its existence in many other angiosperms, including both monocotyledons and dicotyledons, changed the way botanists understood plant reproductive biology. However, it was not until the observation of living material in Monotropa hypopitys that deep insight into isolated aspects of double fertilization was gained (Raghavan 2003).

The evolutionary importance of the endosperm is due to its role in development of the seed (Crane et al. 1995). Following fertilization of the central cell, endosperm not only differentiates into the nutritive tissue for the embryo, but it also plays an important role in the successful development of the embryo in many species (Brink & Cooper 1947). Considering the importance of endosperm for embryo development, the failure of endosperm development in interploidy crosses is enigmatic, and has been has been attributed to differences in ploidy level per se, or to genome incompatibilities between species (Johnston et al. 1980).

Nishimaya and Inomata (1966) postulated that the success of endosperm depended primarily on a 2:1 ratio of the maternal to paternal genome in the endosperm. In the other words, if embryo and endosperm ploidy increase without disrupting the 2m: 1p ratio, normal development of the embryo and endosperm ensues. Vinkenoog and Scott described this phenomenon in relation to what we known as imprinting. Genomic imprinting consists of mechanisms by which genes are expressed in a parent-of-origin mechanisms. These mechanisms, either DNA methylation and/or histone modification during gametogenesis, and thereafter during endosperm development, would explain the specific expression of maternal alleles (Curtis & Grossniklaus 2008) .In Arabidopsis, where imprinting can be manipulated through interploidy crosses (e.g. 2x × 4x; 2m: 2p), seed size variation with respect to endosperm development could be predicted, with gene dosage affecting the timing of cellularization of the endosperm and its proliferation potential (Vinkenoog & Scott 2001).

To understand the phenomenon of endosperm development failure in interploidy crosses, scientists proposed an Endosperm Balanced Number (EBN) hypothesis as an expansion of an Endosperm Balance Number hypothesis developed by Johonston et al. (1980). Based on this hypothesis, each species has an effective ploidy level (termed EBN) that determines its behavior in intra- or inter-specific crosses. In most cases for a cross to be successful, the endosperm must have a ratio of two EBNs from the female parent to one EBN from the male parent. Any deviation from this ratio would be detrimental to endosperm development, and give rise to either a deficient or dead embryo(Carputo et al. 1999).

1.3. Transition from sexual reproduction to asexuality in plants

Angiosperms have evolved to have two distinctive systems for reproduction, including sexual and asexual. The asexual forms include all the mechanisms that lead to production of genetic clones[1] that are identical to the mother plant. Based on geological evidence, the evolution of asexual organisms for the most part occurred during Pleistocene glaciations as most extant asexual animals and plants are evolutionary young and appear on the tips of phylogenetic trees (Schön et al. 2009).

Why sex prevails in nature remains one of the greatest evolutionary enigmas. The first attempts to answer this question were not successful , because for many years it was impossible to accurately identify the consequences of sexuality, or even to distinguish the concept of sexuality from both gender and reproduction  (Stearns 2017). To answer why sex exist in nature, Darwin regarded the variation resulting from sex as a necessary condition for evolution, and he proposed that sex exists due to the physiological advantages incurred during fertilization, which results in vigorous offspring (Schön et al. 2009).

In natural populations, apomixis as well as autogamy[2] are considered non-random mating systems, which deviate from Hardy-Weinberg expectations (Briggs & Walters n.d.).Thus, considering genetic variability, asexual and sexual reproduction differ on a number of levels. For example, the constant creation of new genotypes in a sexual population, along with morphological variation among them are one of the consequences of sexuality.

One of the leading characteristics of sexuality is the generation of genotypic diversity in progeny by chromosome assortment, meiotic recombination and syngamy, and theoretical studies confirm that genetic diversity in terms of polymorphism or heterozygosity may sometimes increase in asexuals if clones are highly heterozygous (Balloux et al. 2003). In this view, apomicts and sexuals package genetic variation in different ways. Apomicts produce uniform but highly heterozygous progeny, each of which is capable of dealing with a different environment. While sexuals produce various heterozygous progeny, each of which may be extremely fit in a particular environment (Stearns 2017). The second prediction of sex for the individual is that, due to elimination of deleterious mutations (see Muller’s Rachet below) expressed in homozygotes of the next generation, the average heterozygosity per genome should decline (Stearns 2017).

The prevalence of sexual reproduction is partially related to the expected lower fitness of asexuality, due to the accumulation of deleterious mutations (Keightley & Eyre-Walker 2000). A large body of theory explains the rarity of asexuality among multicellular taxa by describing benefits created by sexual reproduction(Howard & Lively, 1994;Doncaster, Pound, & Cox, 2000). For example, when genetic associations produced in another time or location are no longer beneficial, sex and recombination can break theses associations and increase the fitness by bringing together fit alleles that tend to be found in different individuals (Otto 2009).

1.3.1. Costs of sex

The prevalence of sexual reproduction is still considered paradoxical because of several known deficiencies and costs of sexual compared to asexual reproduction (Gerber & Kokko 2016). First, in contrast to the accepted role of sex in speeding up adaptive evolution, genetic recombination may break up favorable gene combinations to slow down adaptive evolution(Maynard Smith  1920-2004 1978). Second, in organisms with male-female differentiation, there is so called “two-fold cost” of sex (Hoekstra 2005), whereby August Weismann (Weismann, 1889) proposed that a disadvantage to sexual reproduction was that two individuals are needed to produce an offspring whereas one asexual individual is required to produce an offspring. This “two-fold cost” of sex hypotheses was then elaborated by Maynard Smith based on his experimental studies with parthenogenetic Drosophila in which parthenogenetic females can lay the same overall number of eggs in their lifetime as sexual females (SMITH 1958). In other words, males produced by sexual reproduction do not contribute to reproductive output, and thus the reproductive output per individual for asexual species is twice that for sexual species, hence the twofold cost of sex (Otto & Lenormand 2002).

Following recognition of the costs associated with sex, subsequent theoretical research has focused on finding a large benefit to sex in order to balance its significant costs. Of these, two are considered important, either sex increases the rate of adaptive evolution, and/or it prevents the accumulation of deleterious mutations (Muller, 1932). The most classic explanation in favour of sex is that, it increases the rate of adaptive evolution by generating adaptive gene combinations (Butlin 2002). This hypotheses that was first introduced by Weismann (Weismann,1889)  and then elaborated by Morgan, Fisher, and Muller (Muller 1932) states that sex is beneficial by increasing genetic variation and allowing faster rates of adaptation by combining different beneficial mutations into the same genome (Roze 2012). The fact that sexual populations adapt faster than asexual populations is consistent with these ideas ,and has been the subject of many studies (Malmberg, 1977; Rice & Chippindale, 2001; Goddard et al., 2005). On the other hand, because these studies indicate a population advantage to sex ,and none of them directly competed sexual and asexual populations against one another during adaptation , they do not provide ample evidence for the maintenance of sex within population as demonstrated by John Maynard Smith and George Williams(Becks & Agrawal 2012).

According to Muller’s ratchet theory (Muller 1964), unless a population has some way of eliminating deleterious mutations, they will begin to accumulate over time to continuously decrease viability until the mean absolute fitness of the population becomes less than one and cannot replace itself. At this point, the asexual population is expected to quickly decline to extinction. However, recombination through sexual reproduction can decrease the deleterious effects of Muller’s ratchet.

Further considerations of Muller’s theory has led to the conclusions that sexuals, are able to accumulate genetic mutations which act advantageously in combination with the genetic background of the population in which they arose (Muller 1964). In short, the generation of individuals combining two or more independently –derived mutations that are separately advantageous will be more probable in a sexual compared to an asexual population. In support of this, the rate of accumulation of an advantageous mutant gene in the population that undergoes recombination can be formulated, and show that the evolutionary advantage of sex is lost in sexual species which are obligate selfers. The same is true of organisms such as Oentheras, that have sexual reproduction, but no or very limited recombination between genomes (Muller, 1964).

1.3.2. Short vs. long term advantages of sex

One short term advantage of sex is that sexual off-spring may have higher mean fitness than asexual ones. Note that sex and recombination can have no direct effect on mean fitness, rather they can only affect the variance of  fitness, and accordingly the response to selection and mean fitness after selection (Burt 2000). In contrast , a long term advantage is that sexually-derived progeny are more variable in fitness, leading to faster adaptation compared to their asexual counterparts (BECKS & AGRAWAL 2011).  Nonetheless, this theory has some deficiencies, for example it is not clear that the heritable variance in fitness is significantly increased by sex (Barton & Charlesworth 1998).

Research has also shown that sex evolves more easily when there is spatial heterogeneity in selection, because it helps break down maladaptive gene combinations introduced by migration. In other words, considering the benefits of sexual reproduction, spatially heterogeneous habitats are more favoured than homogenous ones (Becks & Agrawal 2010), as sexual reproduction is advantageous in stressful environments (i.e. abandon-ship hypotheses; Agrawal, Hadany, & Otto, 2005) .Based on this theory, which is mostly true for single-celled organisms, such as bacteria, yeast, and short-lived multicellular invertebrates, increased levels of stress will lead to increased energy allocation to sexual reproduction (Griffiths & Bonser 2013).

1.4. Apomixis mechanisms

While Mendel’s work on genetic inheritance in Pisum is well-known, he actually identified alternative modes of inheritance in plants, including the Pisum and Hieracium types. In the Hieracium type, F1 Hybrids produce offspring like themselves, not like their parents, and later investigations into Mendel’s research illustrated a distinct kind of sexual inheritance in which segregation was absent (Bateson et al. 1909). Ostenfeld was the first to interpret the outcome of Mendel’s crossing experiments on Hieracium as a result of parthenogenesis (i.e. the development of offspring without fertilization). Furthermore, Juel (1989)[i] stated that embryos of Antennaria Alpina develop from unreduced (2n) egg cells with the complete chromosome sets of somatic cells, and today this type of reproduction by seed is known as apomixis (Nogler 2006).

It seems that that there is no significant difference between simple agamospermy[3] and vegetative[4] reproduction. However, many botanists do not consider vegetative reproduction as silimiar to apomixis for a number of reasons (Ramu et al. 2017). Meristems are multicellular, and correspondingly mutations give rise to chimeric tissues. In contrast, apomicts go through a single cell stage, which increases the possibility of mutation, and restricts the chance of viruses to transmit to the progeny (Briggs & Walters n.d.).

Apomixis in plants occur through different mechanisms, it can replace or circumvent the sexual pathways and is characterized by three developmental steps: (i) the reproduction of mitotically-unreduced gametes through a bypass of meiosis during embryo sac formation (apomeiosis), (ii) development of the unreduced gametes into and embryo independent of fertilization (parthenogenesis), and (iii) formation of viable endosperm either with (pseudogamy) or without fertilization (autonomous endosperm) with a sperm cell (Koltunow & Grossniklaus 2003).

In recent years it has been demonstrated that apomixis is under genetic control, and for the genera Panicum, Ranunculus, and Hieracium it is inherited as a single Mendelian trait (Corral et al. 2013). Apomixis occurs in many species from more than 40 genera and is assumed to have evolved independently and multiple times from sexual ancestors. In order to apply apomixis technology in agriculture, a deeper understanding of the mechanisms that regulate reproductive development in plants must be gained.  Although the mechanisms that produce apomixis are diverse, they share common characteristics as apomixis arises through the spatial and temporal deregulation of developmental pathways leading to sexual seed formation (Grossniklaus 2001). From an evolutionary point of view apomixis is considered as a result of sexual failure rather than as a recipe for clonal success (Silvertown 2008).

Apomixis as a natural form of asexual reproduction in plants and animals (typically referred to as parthenogenesis in the latter), has received much attention because of its importance in agriculture for potentially fixing complex hybrid genotypes over generations. Apomixis does not exist in crop plants, and strategies for introducing it from wild relatives into crops have failed. Therefore, understanding the molecular mechanisms involved in apomictic process in natural species has attracted considerable interest (Tucker & Koltunow 2009). For these studies, Boechera has become an interesting model to understand apomixis, because it has both diploid sexual and diploid apomictic species-which  are geographically and morphologically variable (Pellino et al. 2011).

1.4.1. Sexual Reproduction is the default mode in apomictic Hieracium praealtum

It has been demonstrated that sexual reproduction is not completely eliminated in the apomictic subgenus Pilosella species. Instead, some of the apomictic plants produce rare sexually derived progeny called ‘off type’, that comprise sexual hybrids and progeny exhibiting higher and lower ploidy states relative to parental apomict (BICKNELL, LAMBIE, & BUTLER, 2003;Fehrer et al., 2007).Flow cytometric seed screen analyses in the genus Boechera has similarly shown that apomixis is not always 100% penetrant (Aliyu et al. 2010) , thus demonstrating that many apomictic are facultative and that there is interplay between sexual and apomictic pathways in these apomicts (Koltunow et al., 2011).

Deletion mapping of genetic regions associated with apomixis in Hieracium, demonstrated that apomixis in H. caespitosum is controlled by two principal loci. One locus regulates events associated with the avoidance of meiosis (apomeiosis) while the other,  unlinked locus controls the events associated with the avoidance of fertilization (parthenogenesis)(Catanach et al. 2006). In order to elucidate their developmental roles during seed formation, apomixis mutants that had lost function in one or both loci were examined ,and demonstrated that loss of both loci ( LOA and LOP), leads to loss of apomixis and complete reversion to sexual reproduction, suggesting that sexual reproduction seems to be the default reproductive mode in apomictic H. praealtum (Koltunow et al., 2011).

Although different species show differences in apomictic reproduction, all three types of apomixis, including Diplospory, adventitious embryony, and apospory appear directly or indirectly interact with sexual pathways. Comparing morphological and molecular relationships of sexual and apomictic pathways in different species demonstrated that the events of sexual reproduction appear in ovules before development deviated towards apomixis. Thus, it can be inferred that the initiation of sexual reproduction is a prerequisite for apomixis, or that apomixis superimposed itself over sexual system (fig.2)(Tucker & Koltunow 2009).

Fig.2. Working model for the initiation of apomixis.(1) the initiation of sexual reproduction is almost a necessary cue for apomixis.(2) the subsequent initiation of apomixis. Initiation of apomixis could possibly be hindered by spatial or temporal changes to the basic sexual processes ,leading to the production of sexual seeds.(3)subsequent steps of apomictic process until embryo sac maturity take advantage of a basic sexual framework (Taken fromTucker & Koltunow, 2009).

1.4.2. Developmental deviations from sexuality in to apomixis

Apomixis is the result of mechanisms that bypass the fundamental aspects of sexual reproduction, meiosis and fertilization. A failure of meiosis accompanied with the production of diploid embryo sacs has been reported in Dature as the result of a recessive mutation produced through radium treated pollen which inhibited the second meiotic division (Satina & Blakeslee 1935). Finally using expression profiling of 4 developmental stages of ovule development in sexual and apomictic Boechera Sharbel (Sharbel et al. 2010) demonstrated a global gene expression heterochronic shift in gene expression between reproductive forms. Together These observations point to heterochronic shifts of a developmental program in which embryo sac development can occur prior to completion of meiosis,and has been suggested as a characteristic of apomictic development (Koltunow & Grossniklaus 2003).  Considering all aspects of apomixis inhibition of meiosis per se does not necessarily stimulate apomeiosis.

1.4.3. Sexual cues are required for initiation of apomixis

Koltunow and others demonstrated that sexual cues arising during meiotic tetrad formation in ovules of Hieracium and Pilosella are necessary for somatic aposporous initial (Al) cell formation (Fig.3) (Koltunow et al. 2011). These sexual clues range from photoperiod and nutrient levels to hormones, and might influence the events in the ovule or contribute to the degree of apomixis (Koltunow 1993). It has been shown that even the molecular events surrounding sporophytic ovule tissues in Arabidopsis for instance alterations in expression of specific proteins may affect embryo sac, embryo, and endosperm development (Gasser et al. 1998). Nemhauser et al. (Nemhauser et al. 2000) demonstrated that rol oncogenes from Agrobacterium rhizogenes control the fundamental steps in morphogenesis by altering responses to auxin and its presence in Arabidopsis  is crucial for gynoecium morphogenesis. In other words , alterations in ovule structure related to auxin perception influence the frequency and timing of apomixis initiation in Hieracium (Koltunow et al. 2001) and it has also been suggested that theses developmental changes may have an epigenetic basis.

Fig.3. Mechanisms of Apomixis and sexual pathways in Hieracium (drawn from Tucker et al., 2003)

Several lines of evidence suggest that epigenetic regulatory mechanisms are involved in reproduction and early seed development (Baroux, Pien, & Grossniklaus, 2007;Curtis & Grossniklaus, 2008; Olmedo-Monfil et al., 2010). In maize, inactivation of DNA methylation pathways give rise to multiple aposporous-like embryo sacs that do not undergo functional apomixis (Garcia-Aguilar et al. 2010).

1.4.4. Sexual and apomictic development in plants

Apomixis can be subdivided into sporophytic and gametophytic forms, depending on the origin of embryo (Koebner 1994). In sporophytic apomixis, an embryo forms directly from nucellar or integument cells adjacent to a reduced embryo sac, and the fate of resulting adventitious embryos is dependent on the endosperm derived from double fertilization of the reduced embryo sac. In gametophytic apomixis, diplosporous embryos form from the megaspore mother cell (MMC) while aposporous embryos form from other ovule cells (Bicknell & Koltunow 2004).

To identify genetic factors that control apomixis and its differences from sexual reproduction, amplified fragment length polymorphism (AFLP)  technology was used for either selecting molecular markers that co-segregate with apomixis, or for showing disequilibrium with apomixis in natural populations of Hipercium perforatum (Pupilli & Barcaccia 2012). Using these markers apomictically producing plants can be recognized from the sexual plants successfully (Schallau et al. 2010).

Nogler (1984) stated that apomixis may occur when reproduction-specific gene expression is activated at the wrong time and/or place. In support of this, developmental heterochrony and apomixis-like meiotic non-reduction (apomeiosis), parthenogenesis and autonomous endosperm formation has been reported in several mutants of sexual species, suggesting that the expression and ultimate function of the genes critical for sexual development are misregulated in apomicts (Schallau et al. 2010). For example, ovule formation is the same in apomictic and sexual Hieracium, but apomicts differ from sexuals in the timing of initiation of their embryo sac and in the way embryo sacs form within the ovule (Koltunow et al. 1998).

The North American genus Boechera (Brassicacea) is predominantly self-compatible, and consists of sexual, apomictic and facultative apomictic forms (Aliyu et al. 2010). Using a custom-made Boechera-specific microarrays to compare gene expression differences in live microdissected ovules at the MMC stage, it was shown that apomictic alleles (Apoallele)of the APOLLO locus were exclusively expressed in apomictic ovules while sexalleles were not expressed in either sexual or apomictic ovules (Corral et al. 2013). Furthermore, the conserved expression pattern of APOLLO in apomictic Boechera based on qRT-PCR is indicative of its importance in apomictic seed formation (Corral et al. 2013). It is hypothesized that regulatory factors work specifically in apomictic ovules to induce allele-specific tissue expression. A 20-nucleotid conserved polymorphism (TGGCCCGTGAAGTTTATTCC) in the 5’-UTR of apomixis specific alleles has been shown to  imparts multiple putative transcription factor binding sites (Corral et al. 2013).

1.5. Regulatory factors and apomixis

1.5.1. Transcription factors involved in embryo development

In recent years, female gametophyte development has received increasing attention, and current data suggest that female gametophyte development requires the orchestrated activation of several genes that regulate the establishment of cell fate for the formation of a functional female gametophyte. In Arabidopsis for example, a number of genes such as LACHESIS, CLOTHO, ATROPOS, BEL1-LIKE HOMEODOMAIN (BLH1), AGAMOUS- LIKE80 (AGLO80) and AGL61 has been reported to control egg cell fate, and mutation in these genes give rise to abnormal embryo sacs along with female sterility (Groß-Hardt et al., 2007;Pagnussat, Yu, & Sundaresan, 2007;Moll et al., 2008;Steffen, Kang, Portereiko, Lloyd, & Drews, 2008). Furthermore, transcriptome comparisons between wild-type egg-cells and the egg cell of parthenogenetic wheat provides valuable information about the transcription factors involving in gametogenesis (Kőszegi et al. 2011).

In eukaryotes, various RNA polymerases are responsible for the transcription of nuclear genes (ROEDER & RUTTER 1969). The transcriptional machinery in eukaryotes is mainly composed of RNA polymerase II, that is responsible for transcribing all protein-coding genes, as well as several genes that encode noncoding RNAs (Cramer et al. 2008). RNA polymerase II promoters are composed of a number of discrete DNA sequences, including promoter elements, upstream promoter elements, and enhancers, and are binding sites of proteins named transcription factors (TF’s). Transcription factors are proteins that influence the transcription of genes by binding to defined regions of the genome (Latchman 1997). A common feature that all transcription factor share is that they contain DNA-binding domains that recognize specific sequences within the promoter regions of the genes they regulate (Kummerfeld & Teichmann 2006). DNA-binding domains are named according to their structural characteristics, and based on the DNA binding domain they contain, transcription factors of plant and animal origin are classified into four major groups including :(1) basic domain (27.4%), (2) zinc–coordinating DNA-binding domain (15.8%), (3) helix-turn-helix (39.1 %), and (4) β-scaffold factors (Latchman 1997). A common feature that all transcription factor share is that they contain DNA-binding domains that recognize specific sequences within the promoter regions of the genes they regulate (Kummerfeld & Teichmann 2006). DNA-binding domains are named according to their structural characteristics, and based on the DNA binding domain they contain, transcription factors of plant and animal origin are classified into four major groups including :(1) basic domain (27.4%), (2) zinc–coordinating DNA-binding domain (15.8%), (3) helix-turn-helix (39.1 %), and (4) β-scaffold factors with minor groove contacts (17.7%) (Charoensawan, Wilson, & Teichmann, 2010;Qian, Cai, & Li, 2006).

Fig.3. Transcription factor classification. Transcription factors are generally grouped into four distinct classes. Left –up, zinc-coordinating DNA-binding domains. Right-Up, basic domains. Left-bottom, helix-turn-helix. Right bottom β-scaffold factors (drawn from Qian et al., 2006).

1.TCP genes[5] are transcription factors involving in ovule development

TCP genes play an important role in regulating gametophytic development in Orchid, Rice and Arabidopsis. This gene family code plant-specific transcription factors that control diverse developmental traits (Sarvepalli & Nath 2011). The TCP family contains a conserved non-canonical helix-loop-helix (bHLH) domain, which is responsible for DNA binding and dimerization. Gene duplication and diversification has led to establishment of two subfamilies: class I(TCP-P) and class II(TCP-C), based on the primary structure of the basic DNA domain (Cubas et al. 1999). Class I and class II proteins form dimers in solution and evidence support that the TCP domain has a central function in this interaction. These two subfamilies antagonistically modulate plant growth and development through competition in binding to similar Cis-regulatory modules called site II elements (Li 2015).

The TCP family was until recently limited to CYC and TB1, but two additional proteins with similarity in the bHLH region, including PCF1 and PCF2, have been found through database research. These proteins were isolated based on their ability to specifically bind to promoter elements of a rice gene for the proliferating cell nuclear antigen, PCNA[6], a protein that contributes to cell cycle and DNA replication (Jónsson & Hübscher 1997). Studies on promoters of the Arabidopsis PCNA-2 gene show that it is the target of at least five DNA-binding activities of cellular protein extracts that belong to the TCP family of proteins (Cubas 2002).  TCP family transcription factors are regulatory proteins that bind to cis-acting elements named site II motifs in the promoter of the PCNA gene.  These motifs have been shown as essential components for the proliferating cell-specific transcriptional activity of the gene, and were recognized by nuclear proteins that had near-identical binding sites (Kosugi et al. 1995).

1.5.2. The TCP domain basic Region binds DNA

It is the bHLH domain of TCP genes that facilitate its binding to DNA and is necessary for homo- and hetero-dimerization of these transcription factors (Kosugi & Ohashi 1997). Prediction analyses, based upon the chemical and structural properties of DNA binding residues identified the role of the residues in the basic region of TCP domain in DNA interactions (Ahmad & Sarai, 2005;Andrabi, Mizuguchi, Sarai, & Ahmad, 2009). However, in rice PCF1 and PCF2, this basic region was not sufficient for DNA binding (Aggarwal et al. 2010). It has been shown that different parts of the TCP domain, that is to say, the basic region of TCP domain influences the preferences and selectivity of TCP proteins. In addition, the nature of HLH motifs influences the capacity of the basic region to select among different target sequences (Viola et al. 2012).

1.5.3. Interaction behaviors of class I and class II of TCP transcription factors

Several studies on TCP TFs have provided evidence that they can bind DNA as homodimers or heterodimers. Dimerization seems to be necessary for DNA binding, as protein deletions that prevent dimer formation also abolish DNA binding (Aggarwal et al. 2010). To understand the role of different parts of TCP domains in Arabidopsis in one experiment, residues 87 to 103 that take part in dimerization were deleted (TCP4∆6), and the truncated protein failed to bind to DNA (Aggarwal et al. 2010). So far the formation of heterodimers have been reported to occur between specific members of the same class of TCPs (Yang et al., 2012; Danisman et al., 2012; Aguilar-Martínez & Sinha, 2013). In one study where the likelihood of dimerization between PCF1 and PCF2 in rice was investigated, the yeast two-hybrid system was used to show that these two proteins preferentially bind DNA as a heterodimer rather than homodimer (Kosugi & Ohashi 1997).

1.5.4. Regulatory network involve in determination of ovule identity

The ovule of Arabidopsis thaliana represents an ideal system for ovule development studies in plants. To date, most molecular studies of ovule development has focused on Dicot species such as Arabidopsis and Petunia (Tucker & Koltunow 2009), and a number of genes has been demonstrated that are involved in primordium initiation, pattern formation and morphogenesis of ovules in Arabidopsis. It has been proven that MADS box genes SEEDSTICK(STK), SHATTERPROOF1(SHP1), SHP2 ,and AGAMOUS(AG) redundantly  control ovule identity (Pinyopich et al. 2003). In one study in order to investigate the role of these genes in ovule identity, a quadruple mutant of ap2 stk shp1 shp2 was made. Nearly all (95%) ectopic ovules were converted into carpelloid structures and the remaining ovules did not developed into mature ovules (Pinyopich et al. 2003).

Fig.4. Ectopic ovule is largely absent from first-whorl organs of ap2 stk shp1 shp2 mutants(drawn from Pinyopich et al., 2003)

1.5.5. BELL1 transcription factor control ovule development

The genetic network controlling ovule development has been identified and characterized for several years (Colombo et al. 2008). Among different transcription factors involved in ovule development, BELL1 is a major factor controlling ovule patterning, determining identity and development of integument. A mutation on BELL 1 gene lead to a lack of the inner integument and formation of an organ with unknown identity in place of the outer integument. In fact, ovules of Arabidopsis show polarity in at least two axes of symmetry (proximal-distal and the adaxial-abaxial), and P-D axis eventually exhibit considerable bending due to asymmetrical growth which occurs along the anterior- posterior(A-P) axis (Fig.5)(Grossniklaus & Schneitz 1998). In another experiment with unrestricted AG expression in bel mutant ovules or constitutive expression of an AG transgene in a transformant, the ovules converted into a carpel (Ray et al. 1994). Thus, it was speculated that BEL1 might has some effect on preventing ectopic gene expression of the MADS box gene AGAMOUS (AG) in ovules (Bowman et al. 1991). In other words, BEL1 controls ovule development via its negative control of AG. Thus, it is the combinatory effects of regulatory mechanisms that define how an ovule develops from undifferentiated cells (Balasubramanian & Schneitz 2002).

Fig.5.Scheme to highlight the two access for polarity and the postulated Proximal-distal (P-D) pattern elements, and asymmetrical growth of integument along P-D axis (drawn from Grossniklaus & Schneitz, 1998)

1.5.6. The stamen and carpel identity gene AGAMOUS (AG)

One of the transcription factors characteristic , their mobility between cells and even organs, has been subject of many studies in order to decipher the cellular components facilitating intercellular transport of proteins and RNAs (Anon 2004; Jackson 2002; Ruiz-Medrano et al. 2004). Among different MADS-box family of transcription factors, AGAMOUS (AG) which contribute to carpel identity has been known for its ability to move in the L1 layer of developing flowers as well as the inner cells of L1 layer in the floral meristem. These kinds of cell-to-cell movements of AG might suppress the expression of WUS gene in underlying layers (Urbanus et al. 2010). It has been hypothesized that the ability of AG to move inwards in the FM might lead to AG-induced termination of WUS expression ,which results in the consumption of the last mersitemic cells for the proper development of the pistil and ovule (Lohmann et al., 2001;Sablowski, 2007).

1.5.7. Epigenetic regulatory mechanisms during ovule development

Plant gametophyte development gives rise to several cell types with distinct fates following two to three divisions. It has been postulated that epigenetic differentiation of the mitotic daughter nuclei may take place in nuclei before cellularization, which define cell fate. However, it is still enigmatic if changes in chromatin based regulations that control vegetative developmental transitions, could lead to the differentiation between apomictic and sexual reproduction. In one study in maize, in order to identify possible chromatin-level regulators of apomixis, the expression pattern of diverse chromatin-modifying enzymes (CMEs) during reproduction in sexual and apomictic plants was compared. The results were indicative of different expression patterns of CMEs in the ovule of apomictic vs sexual maize, during ovule development (Garcia-Aguilar et al., 2010).

Considering the importance of embryo sac development in plant breeding studies, a significant amount of research has aimed to identify the genes that are expressed in embryo sac through genome-wide transcriptional profiling experiments (Pina et al. 2005) and whole flower and silique transcriptome analyses (Hennig et al. 2004). The results show that the percentage of genes classified into transcriptional regulation among embryo sac and pollen expressed transcriptomes were about 6% to 10% (Johnston et al. 2007). The experiments done on mutants shows that embryo sac expressed genes may play a crucial role during embryo sac development. Among all genes detected in these studies, some of them such as  HOG1 is of special interest due to its role in epigenetic control of embryo and endosperm development through DNA hypo methylation (Rocha et al. 2005).

2. Objectives

Unlike sexual plants that have the chance to fix beneficial mutations, according to “Muller’s Ratchet” theory progeny of asexual plants cannot be recovered once deleterious alleles reach fixation. These processes will increase the rate of deleterious mutation accumulation in asexual lineages (Lynch et al. 1993). It has been proven that, apomicts accumulate mutation in conserved sites such as synonymous sites that are phylogenetically constrained (e.g. regulatory factors) (Lovell et al. 2017). For example, the APOLLO apomixis allele is conserved on the DNA sequence level in virtually all genetic backgrounds and geographic localities of apomictic Boechera (Corral et al. 2013). In fact, among different types of apomixis-specific polymorphism observed in Boechera , a single 20-nucleotide insertion/deletion in the 5’ untranslated region (TGGCCCGTGAAGTTTATTCC)seems to be corresponded to specific transcription factor binding site which is absent in all sex-alleles. This polymorphism, predates the origin of the genus Boechera (Corral et al. 2013). Other studies confirm the rule of APOLLO apomixis allele in the evolutionary success of Boechera through the hybridization-driven spread of this allele in an infectious manner into different sexual genetic backgrounds. After that, recurrent polyploidy mediated by the production of meiotically unreduced gametes has enabled polyploid apomicts to diverge into novel niches (Mau et al. 2015).So, considering the importance of APOLLO conserved motif for its role in fixing apomixis as well as its possible role as being binding sites for TFs , the study of it might be helpful.

1) Identification of the transcription factors and other proteins which interact with the 20-nucleotide insertion in the 5’ UTR of APOLLO apomixis alleles using Y1H.

Regulatory TFs activate or repress transcription of their target genes by binding to cis-regulatory elements that are frequently located in a gene’s promoter.In this experiment in order to understand the mechanisms underlying differential gene expression, we will identify physical interactions between regulatory TFs and their target genes.  We chose two well-characterized Boechera promoters as DNA baits to test the functionality of this Y1H system.  These cloning oligo contains 2×40 repeat sequence.

Sex-APOLLO 5’UTR insertion

(TTTTCCGTAAAAAGAGGAGGATCAATTGCTTTAAAACCCATTTTCCGTAAAAAGAGGAGGATCGATTGCTTTAAAACCCA)

Apo-APOLLO 5’UTR insertion

(AAAGAGGAGGTGGCCCGTGAAGTTTATTCCCTTTAAAACCAAAGAGGAGGTGGCCCGTGAAGTTTATTCCCTTTAAAACC)

We are interested in the highlighted region in red, as we believe it is the DNA bait for the binding of transcription factors; we are looking for loss-of-function or gain-of-function TF binding that arises from this in-del.

The target DNAs sequences of apo-APOLLO and sex-APOLLO (bait) have been sent to Hybrigenics to check against BODIA library and BOSTR library respectively. We are looking forward to see if proteins able to recognize the specific DNA elements which are located in the reporter construct. Interactions will be validated using luciferase or GFP reporter assays, electrophoretic mobility shift assays (EMSA), and chromatin-immunoprecipitation (ChIP) experiments(Ramirez-Parra & Gutierrez 2000).

Boechera yeast libraries – Hybrigenics

Experimental plan

Yeast one-hybrid (2 new bait sequences)

Note: two bait sequences are polymorphisms from the 5’ UTR region of the apo-APOLLO (pApo-APOLLO) and sex-APOLLO (pSex-APOLLO)

1. pApo-APOLLO bait against BODIA library
2. pSex-APOLLO bait against BOSTR library

2) Identifying promoter activity patterns for APOLLO

Aim: (broad) functional understanding of APOLLO

: (specific) expression patterns and promoter elements for sex and apo alleles

1. Compare sequences for promoters of apo and sex APOLLO alleles
2. Clone putative promoter regions of apo and sex APOLLO alleles upstream of GUS gene and express in Arabidopsis
3. Express successful promoter fragments in Boechera
4. Identify promoter elements required for ovule-and whole plant expression (compare pAPOLLO (apo) activity patterns with/without 5’ indel to monitor if indel is required/necessary for ovule-specific expression)

APOLLO is a putative exonuclease which is differentially expressed in apomictic ovules. Sexallele mRNAs of APOLLO have been found ubiquitously at low levels throughout the plant, while apoalleles are expressed highly in apomictic ovules. However, understanding of regulatory elements, and temporal and spatial expression patterns of apo-and sexalleles in Boechera is limited.

Transcriptional expression is frequently regulated by promoter elements immediately upstream of 5’ UTR and start codon (cis-elements). These elements and their associated expression patterns can be investigated using promoter-reporter systems, in which the putative promoter region is cloned upstream of a reporter gene and stably transformed into the host plant. Expression of the reporter is subsequently assessed by fluorescent or colorimetric assay. In plants, the most common of these reporter systems is the β-glucuronidase (GUS) assay.

Interestingly, apoallele mRNAs of APOLLO contain a 20bp insertion in the 5’ UTR, and are truncated upstream of this insertion compared to sexalleles; sequence analysis revealed that this specific insertion imparts multiple putative transcription factor binding sites. One hypothesis for the reproduction-specific expression of APOLLO apoalleles is that this 20bp insertion could lead to transcriptional activation of APOLLO in apomictic premeiotic ovules via generation of a new recognition site for a regulatory element. The requirement of this region for ovule-specific expression of the apoallel is therefore of great interest.

3) Identification of novel transcription factors, including those which may be specific to apomictic plants

During the last few years, the advance in the determination of

TF-binding sites (vivo and in vitro techniques), is helping to read the transcriptional regulatory code (Harbison et al. 2004). For instance, using Chip-based techniques revealed that TFs may bind to thousands of genomic fragments, indicating that the TF is interacting indirectly with DNA or that the binding requires additional cooperative factors (Tanay 2006).

Besides, this method provide valuable information about DNA-binding specificity of transcription factors ,as  proteins belonging to the same subfamily showed similar DNA-recognition patterns . However, despite similarities among them different TFs have distinct DNA-binding profiles. For example, TFs known as shock factors (HSFB2A and HSFC1) recognized identical motifs, representing inverted repeats of the trinucleotide GAA (Perisic et al. 1989). Furthermore, considering the fact that approximately half of the TFs recognized secondary motifs, in some cases completely unrelated to the primary element, it can be inferred that recognition of cis-regulatory elements by TFs is a complicated process (Franco-Zorrilla et al. 2014). In addition, particular tissue specificities for some motifs is observed. For instance, binding sites for the similar ATHB51 are more abundant in DHS derived from floral tissues, indicative of the role of this TF in flower development.

In this experiment we will treat the target cells of Boechera tissues with a crosslinking agent to covalently bind any DNA-binding protein to the chromatin followed by isolation of the protein with all attached DNA via immunoprecipitation. The candidate target gene is associated with a particular DNA-binding protein, and a test for enrichment of the target fragment in the immuneprecipitate compared with controls is performed employing semiquantitive or quantitive PCR (Arce et al. 2016).

4) Genome-wide screening of Boechera genomes to identify other genes potentially regulated by these transcription factors

 

3. Bibliography

Aggarwal, P. et al., 2010. Identification of Specific DNA Binding Residues in the TCP Family of Transcription Factors in <em>Arabidopsis</em> The Plant Cell, 22(4), p.1174 LP-1189. Available at: http://www.plantcell.org/content/22/4/1174.abstract.

Agrawal, A.F., Hadany, L. & Otto, S.P., 2005. The Evolution of Plastic Recombination. Genetics, 171(2), p.803 LP-812. Available at: http://www.genetics.org/content/171/2/803.abstract.

Aguilar-Martínez, J.A. & Sinha, N., 2013. Analysis of the role of Arabidopsis class I TCP genes AtTCP7, AtTCP8, AtTCP22, and AtTCP23 in leaf development. Frontiers in Plant Science, 4, p.406. Available at: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3797442/.

Ahmad, S. & Sarai, A., 2005. PSSM-based prediction of DNA binding sites in proteins. BMC Bioinformatics, 6(1), p.33. Available at: https://doi.org/10.1186/1471-2105-6-33.

Aliyu, O.M., Schranz, M.E. & Sharbel, T.F., 2010. Quantitative variation for apomictic reproduction in the genus Boechera (Brassicaceae). American journal of botany, 97(10), pp.1719–31. Available at: http://www.amjbot.org/cgi/content/long/97/10/1719 [Accessed January 16, 2017].

Andrabi, M. et al., 2009. Prediction of mono- and di-nucleotide-specific DNA-binding sites in proteins using neural networks. BMC Structural Biology, 9(1), p.30. Available at: https://doi.org/10.1186/1472-6807-9-30.

Anon, 2004. Macromolecular Transport and Signaling Through Plasmodesmata. , 235, pp.93–164. Available at: http://www.sciencedirect.com/science/article/pii/S0074769604350035?via%3Dihub [Accessed October 10, 2017].

Arce, A.L. et al., 2016. List of Contributors BT  – Plant Transcription Factors. In Boston: Academic Press, pp. ix–x. Available at: http://www.sciencedirect.com/science/article/pii/B9780128008546000294.

Balasubramanian, S. & Schneitz, K., 2002. <em>NOZZLE</em> links proximal-distal and adaxial-abaxial pattern formation during ovule development in <em>Arabidopsis thaliana</em> Development, 129(18), p.4291 LP-4300. Available at: http://dev.biologists.org/content/129/18/4291.abstract.

Balloux, F., Lehmann, L. & de Meeûs, T., 2003. The population genetics of clonal and partially clonal diploids. Genetics, 164(4), pp.1635–1644. Available at: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1462666/.

Baroux, C., Pien, S. & Grossniklaus, U., 2007. Chromatin modification and remodeling during early seed development. Current Opinion in Genetics & Development, 17(6), pp.473–479. Available at: http://www.sciencedirect.com/science/article/pii/S0959437X07001694.

Barton, N.H. & Charlesworth, B., 1998. Why Sex and Recombination? Science, 281(5385), p.1986 LP-1990. Available at: http://science.sciencemag.org/content/281/5385/1986.abstract.

Bateman, R.M. et al., 1998. EARLY EVOLUTION OF LAND PLANTS: Phylogeny, Physiology, and Ecology of the Primary Terrestrial Radiation. Annual Review of Ecology & Systematics, 29, p.263. Available at: http://cyber.usask.ca/login?url=http://search.ebscohost.com/login.aspx?direct=true&db=a9h&AN=5366173&site=ehost-live.

Bateson, W., Mendel, G. & Mendel, G., 1909. Mendel’s principles of heredity / by W. Bateson., Cambridge : University Press,. Available at: http://www.biodiversitylibrary.org/bibliography/44575 [Accessed July 18, 2017].

Becks, L. & Agrawal, A.F., 2010. Higher rates of sex evolve in spatially heterogeneous environments. Nature, 468(7320), pp.89–92. Available at: http://dx.doi.org/10.1038/nature09449.

Becks, L. & Agrawal, A.F., 2012. The Evolution of Sex Is Favoured During Adaptation to New Environments. PLOS Biology, 10(5), p.e1001317. Available at: https://doi.org/10.1371/journal.pbio.1001317.

BECKS, L. & AGRAWAL, A.F., 2011. The effect of sex on the mean and variance of fitness in facultatively sexual rotifers. Journal of Evolutionary Biology, 24(3), pp.656–664. Available at: http://doi.wiley.com/10.1111/j.1420-9101.2010.02199.x [Accessed July 11, 2017].

Bicknell, R.A. & Koltunow, A.M., 2004. Understanding Apomixis: Recent Advances and Remaining Conundrums. The Plant Cell , 16(suppl 1), pp.S228–S245. Available at: http://www.plantcell.org/content/16/suppl_1/S228.short.

BICKNELL, R.A., LAMBIE, S.C. & BUTLER, R.C., 2003. Quantification of progeny classes in two facultatively apomictic accessions of Hieracium. Hereditas, 138(1), pp.11–20. Available at: http://doi.wiley.com/10.1034/j.1601-5223.2003.01624.x [Accessed July 25, 2017].

Bowman, J.L., Drews, G.N. & Meyerowitz, E.M., 1991. Expression of the Arabidopsis floral homeotic gene AGAMOUS is restricted to specific cell types late in flower development. The Plant Cell, 3(8), p.749 LP-758. Available at: http://www.plantcell.org/content/3/8/749.abstract.

Briggs, D. (David) & Walters, S.M. (Stuart M., Plant variation and evolution, Available at: http://sundog.usask.ca/record=b4132828~S8#.WYitLAtjhlo.mendeley [Accessed August 7, 2017].

Brink, R.A. & Cooper, D.C., 1947. The endosperm in seed development. The Botanical Review, 13(9), pp.479–541. Available at: http://dx.doi.org/10.1007/BF02861549.

Burt, A., 2000. Perspective: Sex, Recombination, and the Efficacy of Selection-Was Weismann Right? Evolution, 54(2), pp.337–351. Available at: http://www.jstor.org/stable/2640842.

Butlin, R., 2002. The costs and benefits of sex: new insights from old asexual lineages. Nat Rev Genet, 3(4), pp.311–317. Available at: http://dx.doi.org/10.1038/nrg749.

Carputo, D. et al., 1999. Uses and usefulness of endosperm balance number. Theoretical and Applied Genetics, 98(3), pp.478–484. Available at: http://dx.doi.org/10.1007/s001220051095.

Catanach, A.S. et al., 2006. Deletion mapping of genetic regions associated with apomixis in Hieracium. Proceedings of the National Academy of Sciences of the United States of America, 103(49), pp.18650–5. Available at: http://www.ncbi.nlm.nih.gov/pubmed/17047034 [Accessed July 26, 2017].

Charlesworth, B., 1991. The Evolution of Sex Chromosomes. Science, 251(4997), pp.1030–1033. Available at: http://www.jstor.org/stable/2875215.

Charoensawan, V., Wilson, D. & Teichmann, S.A., 2010. Genomic repertoires of DNA-binding transcription factors across the tree of life. Nucleic Acids Research, 38(21), pp.7364–7377. Available at: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2995046/.

Colombo, L., Battaglia, R. & Kater, M.M., 2008. Arabidopsis ovule development and its evolutionary conservation. Trends in Plant Science, 13(8), pp.444–450. Available at: http://www.sciencedirect.com/science/article/pii/S1360138508001611.

Corral, J.M. et al., 2013. A Conserved Apomixis-Specific Polymorphism Is Correlated with Exclusive Exonuclease Expression in Premeiotic Ovules of Apomictic Boechera Species. Plant Physiology , 163(4), pp.1660–1672. Available at: http://www.plantphysiol.org/content/163/4/1660.abstract.

Cramer, P. et al., 2008. Structure of Eukaryotic RNA Polymerases. Annual Review of Biophysics, 37(1), pp.337–352. Available at: https://doi.org/10.1146/annurev.biophys.37.032807.130008.

Crane, P.R., Friis, E.M. & Pedersen, K.R., 1995. The origin and early diversification of angiosperms. Nature, 374(6517), pp.27–33. Available at: http://dx.doi.org/10.1038/374027a0.

Cubas, P., 2002. Role of TCP genes in the evolution of morphological characters in angiosperms. In Developmental Genetics and Plant Evolution. Systematics Association Special Volumes. CRC Press, pp. 247–266. Available at: https://doi.org/10.1201/9781420024982.ch13.

Cubas, P. et al., 1999. The TCP domain: a motif found in proteins regulating plant growth and development. The Plant Journal, 18(2), pp.215–222. Available at: http://doi.wiley.com/10.1046/j.1365-313X.1999.00444.x [Accessed July 28, 2017].

Curtis, M.D. & Grossniklaus, U., 2008. Molecular control of autonomous embryo and endosperm development. Sexual Plant Reproduction, 21(1), pp.79–88. Available at: https://doi.org/10.1007/s00497-007-0061-9.

Danisman, S. et al., 2012. Arabidopsis Class I and Class II TCP Transcription Factors Regulate Jasmonic Acid Metabolism and Leaf Development Antagonistically. Plant Physiology, 159(4), p.1511 LP-1523. Available at: http://www.plantphysiol.org/content/159/4/1511.abstract.

Doncaster, C.P., Pound, G.E. & Cox, S.J., 2000. The ecological cost of sex. Nature, 404(6775), pp.281–285. Available at: http://dx.doi.org/10.1038/35005078.

Fehrer, J. et al., 2007. Incongruent plastid and nuclear DNA phylogenies reveal ancient intergeneric hybridization in Pilosella hawkweeds (Hieracium, Cichorieae, Asteraceae). Molecular Phylogenetics and Evolution, 42(2), pp.347–361. Available at: http://www.sciencedirect.com/science/article/pii/S1055790306002752.

Franco-Zorrilla, J.M. et al., 2014. DNA-binding specificities of plant transcription factors and their potential to define target genes. Proceedings of the National Academy of Sciences , 111(6), pp.2367–2372. Available at: http://www.pnas.org/content/111/6/2367.abstract.

Garcia-Aguilar, M. et al., 2010. Inactivation of a DNA Methylation Pathway in Maize Reproductive Organs Results in Apomixis-Like Phenotypes. The Plant Cell, 22(10), p.3249 LP-3267. Available at: http://www.plantcell.org/content/22/10/3249.abstract.

Gasser, C.S., Broadhvest, J. & Hauser, B.A., 1998. GENETIC ANALYSIS OF OVULE DEVELOPMENT. Annual Review of Plant Physiology and Plant Molecular Biology, 49(1), pp.1–24. Available at: https://doi.org/10.1146/annurev.arplant.49.1.1.

Gerber, N. & Kokko, H., 2016. Sexual conflict and the evolution of asexuality at low population densities. Proceedings of the Royal Society B: Biological Sciences, 283(1841). Available at: http://rspb.royalsocietypublishing.org/content/283/1841/20161280.abstract.

Goddard, M.R., Godfray, H.C.J. & Burt, A., 2005. Sex increases the efficacy of natural selection in experimental yeast populations. Nature, 434(7033), pp.636–640. Available at: http://dx.doi.org/10.1038/nature03405.

Griffiths, J.G. & Bonser, S.P., 2013. Is Sex Advantageous in Adverse Environments? A Test of the Abandon-Ship Hypothesis. The American Naturalist, 182(6), pp.718–725. Available at: https://doi.org/10.1086/673476.

Groß-Hardt, R. et al., 2007.  LACHESIS Restricts Gametic Cell Fate in the Female Gametophyte of Arabidopsis  J. C. Carrington, ed. PLoS Biology, 5(3), p.e47. Available at: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1804285/.

Grossniklaus, U., 2001. From sexuality to apomixis: molecular and genetic approaches Y. Savidan, J. G. Carman, & T. Dresselhaus, eds.

Grossniklaus, U. & Schneitz, K., 1998. The molecular and genetic basis of ovule and megagametophyte development. Semin Cell Dev Biol, 9.

Harbison, C.T. et al., 2004. Transcriptional regulatory code of a eukaryotic genome. Nature, 431(7004), pp.99–104. Available at: http://dx.doi.org/10.1038/nature02800.

Hennig, L. et al., 2004. Transcriptional Programs of Early Reproductive Stages in Arabidopsis. Plant Physiology, 135(3), p.1765 LP-1775. Available at: http://www.plantphysiol.org/content/135/3/1765.abstract.

Higashiyama, T. et al., 2001. Pollen Tube Attraction by the Synergid Cell. Science, 293(5534), p.1480 LP-1483. Available at: http://science.sciencemag.org/content/293/5534/1480.abstract.

Hoekstra, R.F., 2005. Evolutionary biology:  Why sex is good. Nature, 434(7033), pp.571–573. Available at: http://dx.doi.org/10.1038/434571a.

Howard, R.S. & Lively, C.M., 1994. Parasitism, mutation accumulation and the maintenance of sex. Nature, 367(6463), pp.554–557. Available at: http://dx.doi.org/10.1038/367554a0.

Jackson, D., 2002. Double Labeling of KNOTTED1 mRNA and Protein Reveals Multiple Potential Sites of Protein Trafficking in the Shoot Apex. Plant Physiology, 129(4), p.1423 LP-1429. Available at: http://www.plantphysiol.org/content/129/4/1423.abstract.

Johnston, A.J. et al., 2007. Genetic subtraction profiling identifies genes essential for Arabidopsisreproduction and reveals interaction between the female gametophyte and the maternal sporophyte. Genome Biology, 8(10), p.R204. Available at: https://doi.org/10.1186/gb-2007-8-10-r204.

Johnston, S.A. et al., 1980. The significance of genic balance to endosperm development in interspecific crosses. Theoretical and Applied Genetics, 57(1), pp.5–9. Available at: http://dx.doi.org/10.1007/BF00276002.

Jónsson, Z.O. & Hübscher, U., 1997. Proliferating cell nuclear antigen: More than a clamp for DNA polymerases. BioEssays, 19(11), pp.967–975. Available at: http://doi.wiley.com/10.1002/bies.950191106 [Accessed July 28, 2017].

Keightley, P.D. & Eyre-Walker, A., 2000. Deleterious Mutations and the Evolution of Sex. Science, 290(5490), p.331 LP-333. Available at: http://science.sciencemag.org/content/290/5490/331.abstract.

Koebner, R., 1994. Apomixis in Plants. By Asker S. E. and Jerling L.. Boca Raton and London: CRC Press (1992), pp. 298, £105.00, ISBN 0-8493-4545-6. Experimental Agriculture, 30(1), p.107. Available at: https://www.cambridge.org/core/article/apomixis-in-plants-by-asker-s-e-and-jerling-l-boca-raton-and-london-crc-press-1992-pp-298-10500-isbn-0849345456/AA41F492566437D9FA0BF3257C881773.

Koltunow, A.M., 1993. Apomixis: Embryo Sacs and Embryos Formed without Meiosis or Fertilization in Ovules. The Plant Cell, 5(10), pp.1425–1437. Available at: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC160373/.

Koltunow, A.M. et al., 2001. Expression of rolB in apomictic Hieracium piloselloides Vill. causes ectopic meristems in planta and changes in ovule formation, where apomixis initiates at higher frequency. Planta, 214(2), pp.196–205. Available at: https://doi.org/10.1007/s004250100612.

Koltunow, A.M. & Grossniklaus, U., 2003. Apomixis: A developmental perspective. Annu Rev Plant Biol, 54. Available at: http://dx.doi.org/10.1146/annurev.arplant.54.110901.160842.

Koltunow, A.M., Johnson, S.D. & Bicknell, R.A., 1998. Sexual and apomictic development in Hieracium. Sexual Plant Reproduction, 11(4), pp.213–230. Available at: https://doi.org/10.1007/s004970050144.

Koltunow, A.M.G. et al., 2011. Sexual reproduction is the default mode in apomictic Hieracium subgenus Pilosella, in which two dominant loci function to enable apomixis. The Plant Journal, 66(5), pp.890–902. Available at: http://doi.wiley.com/10.1111/j.1365-313X.2011.04556.x [Accessed July 25, 2017].

Kosugi, S. & Ohashi, Y., 1997. PCF1 and PCF2 specifically bind to cis elements in the rice proliferating cell nuclear antigen gene. The Plant Cell, 9(9), p.1607 LP-1619. Available at: http://www.plantcell.org/content/9/9/1607.abstract.

Kosugi, S., Suzuka, I. & Ohashi, Y., 1995. Two of three promoter elements identified in a rice gene for proliferating cell nuclear antigen are essential for meristematic tissue-specific expression. The Plant Journal, 7(6), pp.877–886. Available at: http://doi.wiley.com/10.1046/j.1365-313X.1995.07060877.x [Accessed August 1, 2017].

Kőszegi, D. et al., 2011. Members of the RKD transcription factor family induce an egg cell-like gene expression program. The Plant Journal, 67(2), pp.280–291. Available at: http://doi.wiley.com/10.1111/j.1365-313X.2011.04592.x [Accessed August 3, 2017].

Kummerfeld, S.K. & Teichmann, S.A., 2006. DBD: a transcription factor prediction database. Nucleic Acids Research, 34(suppl_1), pp.D74–D81. Available at: http://dx.doi.org/10.1093/nar/gkj131.

Latchman, D.S., 1997. Transcription factors: An overview. The International Journal of Biochemistry & Cell Biology, 29(12), pp.1305–1312. Available at: http://www.sciencedirect.com/science/article/pii/S135727259700085X.

Li, S., 2015. The Arabidopsis thaliana TCP transcription factors: A broadening horizon beyond development. Plant Signaling & Behavior, 10(7), p.e1044192. Available at: http://dx.doi.org/10.1080/15592324.2015.1044192.

Lohmann, J.U. et al., 2001. A Molecular Link between Stem Cell Regulation and Floral Patterning in Arabidopsis. Cell, 105(6), pp.793–803. Available at: http://www.sciencedirect.com/science/article/pii/S0092867401003841.

Lovell, J.T. et al., 2017. Mutation Accumulation in an Asexual Relative of Arabidopsis. PLOS Genetics, 13(1), p.e1006550. Available at: https://doi.org/10.1371/journal.pgen.1006550.

Lynch, M. et al., 1993. The Mutational Meltdown in Asexual Populations. Journal of Heredity, 84(5), pp.339–344. Available at: http://dx.doi.org/10.1093/oxfordjournals.jhered.a111354.

Malmberg, R.L., 1977. THE EVOLUTION OF EPISTASIS AND THE ADVANTAGE OF RECOMBINATION IN POPULATIONS OF BACTERIOPHAGE T4. Genetics, 86(3), p.607 LP-621. Available at: http://www.genetics.org/content/86/3/607.abstract.

Martín-Trillo, M. & Cubas, P., 2010. TCP genes: a family snapshot ten years later. Trends in plant science, 15(1), pp.31–9. Available at: http://www.ncbi.nlm.nih.gov/pubmed/19963426 [Accessed September 17, 2017].

Mau, M. et al., 2015. Hybrid apomicts trapped in the ecological niches of their sexual ancestors. Proceedings of the National Academy of Sciences of the United States of America, 112(18), pp.E2357–E2365. Available at: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4426457/.

Maynard Smith  1920-2004, J., 1978. The evolution of sex, Cambridge [Eng.] : Cambridge Eng. .

Moll, C. et al., 2008. CLO/GFA1 and ATO are novel regulators of gametic cell fate in plants. The Plant Journal, 56(6), pp.913–921. Available at: http://doi.wiley.com/10.1111/j.1365-313X.2008.03650.x [Accessed August 3, 2017].

Muller, H.J., 1932. Some Genetic Aspects of Sex. The American Naturalist, 66(703), pp.118–138. Available at: https://doi.org/10.1086/280418.

Muller, H.J., 1964. The relation of recombination to mutational advance. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis, 1(1), pp.2–9. Available at: http://www.sciencedirect.com/science/article/pii/0027510764900478.

Nemhauser, J.L., Feldman, L.J. & Zambryski, P.C., 2000. Auxin and ETTIN in Arabidopsis gynoecium morphogenesis. Development, 127(18), p.3877 LP-3888. Available at: http://dev.biologists.org/content/127/18/3877.abstract.

Nogler, G.A., 2006. The Lesser-Known Mendel: His Experiments on Hieracium. Genetics, 172(1), p.1 LP-6. Available at: http://www.genetics.org/content/172/1/1.abstract.

Olmedo-Monfil, V. et al., 2010. Control of female gamete formation by a small RNA pathway in Arabidopsis.

Otto, S.P., 2009. The Evolutionary Enigma of Sex. The American Naturalist, 174(S1), pp.S1–S14. Available at: http://dx.doi.org/10.1086/599084.

Otto, S.P. & Lenormand, T., 2002. Resolving the paradox of sex and recombination. Nat Rev Genet, 3(4), pp.252–261. Available at: http://dx.doi.org/10.1038/nrg761.

Pagnussat, G.C., Yu, H.-J. & Sundaresan, V., 2007. Cell-Fate Switch of Synergid to Egg Cell in Arabidopsis eostre Mutant Embryo Sacs Arises from Misexpression of the BEL1-Like Homeodomain Gene BLH1. The Plant Cell, 19(11), pp.3578–3592. Available at: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2174879/.

Pellino, M. et al., 2011. Selection of reference genes for quantitative real-time PCR expression studies of micro-dissected reproductive tissues in apomictic and sexual Boechera. BMC Research Notes, 4. Available at: http://dx.doi.org/10.1186/1756-0500-4-303.

Pennington, R.T., 2002. Willis, K.J., McElwain, J.C. The evolution of plants. Annals of Botany, 90(5), pp.678–679. Available at: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4240448/.

Perisic, O., Xiao, H. & Lis, J.T., 1989. Stable binding of Drosophila heat shock factor to head-to-head and tail-to-tail repeats of a conserved 5 bp recognition unit. Cell, 59(5), pp.797–806. Available at: http://www.sciencedirect.com/science/article/pii/009286748990603X.

Pina, C. et al., 2005. Gene Family Analysis of the Arabidopsis Pollen Transcriptome Reveals Biological Implications for Cell Growth, Division Control, and Gene Expression Regulation. Plant Physiology, 138(2), p.744 LP-756. Available at: http://www.plantphysiol.org/content/138/2/744.abstract.

Pinyopich, A. et al., 2003. Assessing the redundancy of MADS-box genes during carpel and ovule development. Nature, 424(6944), pp.85–88. Available at: http://dx.doi.org/10.1038/nature01741.

Pupilli, F. & Barcaccia, G., 2012. Cloning plants by seeds: Inheritance models and candidate genes to increase fundamental knowledge for engineering apomixis in sexual crops. Journal of Biotechnology, 159(4), pp.291–311. Available at: http://www.sciencedirect.com/science/article/pii/S0168165611004986 [Accessed May 17, 2017].

Qian, Z., Cai, Y.-D. & Li, Y., 2006. Automatic transcription factor classifier based on functional domain composition. Biochemical and Biophysical Research Communications, 347(1), pp.141–144. Available at: http://www.sciencedirect.com/science/article/pii/S0006291X0601357X.

Raghavan, V., 2006. Double Fertilization: Embryo and Endosperm Development in Flowering Plants, Springer Berlin Heidelberg. Available at: https://books.google.ca/books?id=YUfqyH9uRXwC.

Raghavan, V., 2003. Some reflections on double fertilization, from its discovery to the present. New Phytologist, 159(3), pp.565–583. Available at: http://doi.wiley.com/10.1046/j.1469-8137.2003.00846.x [Accessed May 19, 2017].

Ramirez-Parra, E. & Gutierrez, C., 2000. Characterization of wheat DP, a heterodimerization partner of the plant E2F transcription factor which stimulates E2F-DNA binding. FEBS Lett, 486. Available at: http://dx.doi.org/10.1016/S0014-5793(00)02239-0.

Ramu, P. et al., 2017. Cassava haplotype map highlights fixation of deleterious mutations during clonal propagation. Nat Genet, 49(6), pp.959–963. Available at: http://dx.doi.org/10.1038/ng.3845.

Ray, A. et al., 1994. Arabidopsis floral homeotic gene BELL (BEL1) controls ovule development through negative regulation of AGAMOUS gene (AG). Proceedings of the National Academy of Sciences , 91(13), pp.5761–5765. Available at: http://www.pnas.org/content/91/13/5761.abstract.

Rice, W.R. & Chippindale, A.K., 2001. Sexual Recombination and the Power of Natural Selection. Science, 294(5542), p.555 LP-559. Available at: http://science.sciencemag.org/content/294/5542/555.abstract.

Rocha, P.S.C.F. et al., 2005. The Arabidopsis <em>HOMOLOGY-DEPENDENT GENE SILENCING1</em> Gene Codes for an <em>S</em>-Adenosyl-<span class="sc">l</span>-Homocysteine Hydrolase Required for DNA Methylation-Dependent Gene Silencing. The Plant Cell, 17(2), p.404 LP-417. Available at: http://www.plantcell.org/content/17/2/404.abstract.

ROEDER, R.G. & RUTTER, W.J., 1969. Multiple Forms of DNA-dependent RNA Polymerase in Eukaryotic Organisms. Nature, 224(5216), pp.234–237. Available at: http://dx.doi.org/10.1038/224234a0.

Roze, D., 2012. Disentangling the Benefits of Sex. PLOS Biology, 10(5), p.e1001321. Available at: https://doi.org/10.1371/journal.pbio.1001321.

Ruiz-Medrano, R., Xoconostle-Cazares, B. & Kragler, F., 2004. The plasmodesmatal transport pathway for homeotic proteins, silencing signals and viruses. Current opinion in plant biology, 7(6), p.641—650. Available at: https://doi.org/10.1016/j.pbi.2004.09.012.

Sablowski, R., 2007. Flowering and determinacy in Arabidopsis. Journal of Experimental Botany, 58(5), pp.899–907. Available at: http://dx.doi.org/10.1093/jxb/erm002.

Sarvepalli, K. & Nath, U., 2011. Hyper-activation of the TCP4 transcription factor in Arabidopsis thaliana accelerates multiple aspects of plant maturation. The Plant Journal, 67(4), pp.595–607. Available at: http://doi.wiley.com/10.1111/j.1365-313X.2011.04616.x [Accessed July 27, 2017].

Satina, S. & Blakeslee, A.F., 1935. Cytological Effects of a Gene in Datura which Causes Dyad Formation in Sporogenesis. Botanical Gazette, 96(3), pp.521–532. Available at: https://doi.org/10.1086/334498.

Schallau, A. et al., 2010. Identification and genetic analysis of the APOSPORY locus in Hypericum perforatum L. The Plant journal : for cell and molecular biology, 62(5), pp.773–84. Available at: http://www.ncbi.nlm.nih.gov/pubmed/20202173 [Accessed January 18, 2017].

Schön, I., Martens, K. (Koen) & Dijk, P. van (Peter J.., 2009. Lost sex : the evolutionary biology of parthenogenesis, Springer.

Schön, I., Martens, K. & Dijk, P. eds., 2009. Lost Sex, Dordrecht: Springer Netherlands. Available at: http://link.springer.com/10.1007/978-90-481-2770-2 [Accessed July 10, 2017].

Sharbel, T.F. et al., 2010. Apomictic and sexual ovules of Boechera display heterochronic global gene expression patterns. Plant Cell, 22. Available at: http://dx.doi.org/10.1105/tpc.109.072223.

Silvertown, J., 2008. The Evolutionary Maintenance of Sexual Reproduction: Evidence from the Ecological Distribution of Asexual Reproduction in Clonal Plants. International Journal of Plant Sciences, 169(1), pp.157–168. Available at: https://doi.org/10.1086/523357.

SMITH, J.M., 1958. The Effects of Temperature and of Egg-Laying on the Longevity of <em>Drosophila Subobscura</em> Journal of Experimental Biology, 35(4), p.832 LP-842. Available at: http://jeb.biologists.org/content/35/4/832.abstract.

Stearns, S.C., 2017. The masterpiece of nature: The evolution and genetics of sexuality. Ethology and Sociobiology, 5(1), pp.73–75. Available at: http://dx.doi.org/10.1016/0162-3095(84)90043-8.

Steffen, J.G. et al., 2008. AGL61 Interacts with AGL80 and Is Required for Central Cell Development in Arabidopsis. Plant Physiology, 148(1), pp.259–268. Available at: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2528130/.

Tanay, A., 2006. Extensive low-affinity transcriptional interactions in the yeast genome. Genome Research, 16(8), pp.962–972. Available at: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1524868/.

Tucker, M.R. et al., 2003. Sexual and Apomictic Reproduction in Hieracium Subgenus Pilosella Are Closely Interrelated Developmental Pathways. The Plant Cell, 15(7), pp.1524–1537.

Tucker, M.R. & Koltunow, A.M.G., 2009. Sexual and asexual (apomictic) seed development in flowering plants: molecular, morphological and evolutionary relationships. Functional Plant Biology, 36(6), pp.490–504. Available at: https://doi.org/10.1071/FP09078.

Urbanus, S.L. et al., 2010. Intercellular transport of epidermis-expressed MADS domain transcription factors and their effect on plant morphology and floral transition. The Plant Journal, 63(1), p.no-no. Available at: http://doi.wiley.com/10.1111/j.1365-313X.2010.04221.x [Accessed October 2, 2017].

Vinkenoog, R. & Scott, R.J., 2001. Autonomous endosperm development in flowering plants: how to overcome the imprinting problem? Sexual Plant Reproduction, 14(4), pp.189–194. Available at: http://dx.doi.org/10.1007/s00497-001-0106-4.

Viola, I.L. et al., 2012. Determinants of the DNA Binding Specificity of Class I and Class II TCP Transcription Factors. Journal of Biological Chemistry , 287(1), pp.347–356. Available at: http://www.jbc.org/content/287/1/347.abstract.

Yang, X. et al., 2012. Evolution of Double Positive Autoregulatory Feedback Loops in CYCLOIDEA2 Clade Genes Is Associated with the Origin of Floral Zygomorphy. The Plant Cell, 24(5), pp.1834–1847. Available at: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3442572/.

[1] Clones are conspecific populations of asexual organisms grouped based on arbitrary degree of morphological resemblance

[2] Self-fertilization

[3] Asexual reproduction through seed

[4] Reproduction through somatic cells like stolons

[5] TCP genes encodes plant-specific transcription factors with a bLHL motifs that allow DNA binding and protein-protein interactions (Martín-Trillo & Cubas 2010).

[6] PCNA is known as an auxiliary protein of DNA polymerase δ, and is one of the factors that are essential for the synthesis of the leading strand during replication in vitro of simian virus 40 DNA(Kosugi et al. 1995)

• [i] Juel, H. O., 1898. Parthenogenesis bei Antennaria alpina (L.). R. Br. Bot. Centralblatt 74(13): 369–372.