Skip to content

⭐ Rated 4.9/5 by 8,400+ students  |  🎓 Expert writers in 80+ subjects  |  ✅ 100% original, no AI  |  🔒 Confidential & secure

Home Blog

Molecular Characterization of Fungi Through 18S rRNA Studies

5 min read

4.4.1 Isolation of genomic DNA from fungi

18S rRNA sequencing for fungi was performed using universal primers. DNA isolation was done with NucleoSpin® Plant II Kit (Macherey-Nagel) (Andrade-Monteiro et al., 2000).

About 25 mg of the fungal mycelium was homogenized using liquid nitrogen and the powdered tissue was transferred to a microcentrifuge tube. Four hundred microlitres of buffer PL1 was added and vortexed for 1 minute. Ten microlitres of RNase A solution was added and inverted to mix. The homogenate was incubated at 65oC for 10 minutes. The lysate was transferred to a Nucleospin filter and centrifuged at 11000 x g for 2 minutes. The flow through liquid was collected and the filter was discarded. Four hundred and fifty microlitres of buffer PC was added and mixed well. The solution was transferred to a Nucleospin Plant II column, centrifuged for 1 minute and the flow through liquid was discarded. Four hundred microlitre buffer PW1 was added to the column, centrifuged at 11000 x g for 1 minute and flow though liquid was discarded.  Then 700 µl PW2 was added, centrifuged at 11000 x g and flow through liquid was discarded. Finally 200 µl of PW2 was added and centrifuged at 11000 x g for 2 minutes to dry the silica membrane. The column was transferred to a new 1.7 ml tube and 50 µl of buffer PE was added and incubated at 65oC for 5 minutes. The column was then centrifuged at 11000 x g for 1 minute to elute the DNA. The eluted DNA was stored at 4oC.

4.4.2 Agarose Gel Electrophoresis for DNA Quality and Quantity check

The quality of the DNA isolated was checked using agarose gel electrophoresis. 1µl of 6X gel-loading buffer (0.25% bromophenol blue, 30% sucrose in TE buffer pH-8.0) was added to 5µl of DNA. The samples were loaded to 0.8% agarose gel prepared in 0.5X TBE (Tris-Borate-EDTA) buffer containing 0.5 µg/ml ethidium bromide. Electrophoresis was performed with 0.5X TBE as electrophoresis buffer at 75 V until bromophenol dye front has migrated to the bottom of the gel. The gels were visualized in a UV transilluminator (Genei) and the image was captured under UV light using Gel documentation system (Bio-Rad)

4.4.3 PCR analysis

PCR amplification reactions were carried out in a 20 µl reaction volume which contained 1X PCR buffer (100mM Tris HCl , pH-8.3; 500mM KCl), 0.2mM each dNTPs (dATP, dGTP, dCTP and dTTP), 2.5mM MgCl2, 1 unit of AmpliTaq Gold DNA polymerase enzyme, 0.1 mg/ml BSA, 4% DMSO, 5pM of forward and reverse primers and FTA disc as template.

Primers used

Target Primer name Direction Sequence (5’ 3’)
18S NS1 Forward GTAGTCATATGCTTGTCTC
NS4 Reverse CTTCCGTCAATTCCTTTAAG

The PCR amplification was carried out in a PCR thermal cycler (GeneAmp PCR System 9700, Applied Biosystems).

PCR  18S

95 oC  – 5.00 min

  95 oC – 30 sec

54 oC – 40 sec 40 cycles

72 oC – 60 sec

72 oC – 7.00 min

4 oC – ∞

4.4.4 Agarose Gel electrophoresis of PCR products

The PCR products were checked in 1.2% agarose gel prepared in 0.5X TBE buffer containing 0.5 µg/ml ethidium bromide. 1 µl of 6X loading dye was mixed with 5 µl of PCR products and was loaded and electrophoresis was performed at 75V power supply with 0.5X TBE as electrophoresis buffer for about 1 to 2 hours, until the bromophenol blue front had migrated to almost the bottom of the gel. The molecular standard used was a 2-log DNA ladder (NEB). The gels were visualized in a UV transilluminator (Genei) and the image was captured under UV light using Gel documentation system (Bio-Rad)

4.4.5 ExoSAP-IT Treatment

Coursework piling up? Get expert help today.

Whether it's weekly coursework, term assignments, or portfolio tasks, our writers understand module-level expectations. We match you with a writer in your subject area who delivers fully referenced, properly formatted coursework on your exact deadline.

✓ Plagiarism-free · ✓ 100% human · ✓ Free revisions · ✓ Confidential

Help With My Coursework

🔒 No payment to start · From 3 hrs

ExoSAP-IT (USB) consists of two hydrolytic enzymes, Exonuclease I and Shrimp Alkaline Phosphatase (SAP), in a specially formulated buffer for the removal of unwanted primers and dNTPs from a PCR product mixture with no interference in downstream applications.

Five micro litres of PCR product is mixed with 2 µl of ExoSAP-IT and incubated at 37oC for 15 minutes followed by enzyme inactivation at 80oC for 15 minutes.

4.4.6 Sequencing using Big Dye Terminator v3.1

Sequencing reaction was done in a PCR thermal cycler (GeneAmp PCR System 9700, Applied Biosystems) using the BigDye Terminator v3.1 Cycle sequencing Kit (Applied Biosystems, USA) following manufactures protocol.

The PCR mix consisted of the following components:

PCR Product (ExoSAP treated)  -10-20 ng

Primer     -3.2 pM (either Forward or Reverse)

Sequencing Mix   -0.28 µl

Reaction buffer   -1.86 µl

Sterile distilled water  -make up to 10µl

The sequencing PCR temperature profile consisted of a 1st cycle at 96oC for 2 minutes followed by 30 cycles at 96oC for 30 sec, 50oC for 40 sec and 60oC for 4 minutes.

4.4.7 Post sequencing PCR clean up

  1. Master mix I of 10µl milli Q and 2µl 125mM EDTA per reaction and master mix II of 2µl of 3M sodium acetate pH 4.6 and 50 µl of ethanol were prepared.
  2. 12µl of master mix I was added to each reaction containing 10µl of reaction contents and was properly mixed.
  3. 52 µl of master mix II was added to each reaction.
  4. Contents were mixed by inverting and incubated at room temperature for 30 minutes
  5. Spun  at 14,000 rpm for 30 minutes
  6. Decanted the supernatant and added 100µl of 70% ethanol
  7. Spun at 14,000 rpm for 20 minutes.
  8. Decanted the supernatant and repeated 70% ethanol wash
  9. Decanted the supernatant and air dried the pellet.

The cleaned up air dried product was sequenced in ABI 3730 DNA Analyzer (Applied Biosystems).

4.4.8 Sequence analysis

The sequence quality was checked using Sequence Scanner Software v1 (Applied Biosystems). Sequence alignment and required editing of the obtained sequences were carried out using Geneious Pro v5.6 (Drummond et al., 2012).

4.5 IDENTIFICATION OF BIOACTIVE COMPOUNDS BY GAS           CHROMATOGRAPHY- MASS SPECTRUM (GC-MS) ANALYSIS

GC-MS technique was used to identify the phytochemicals in the solvent extracts of leaves and stem of Hypericum hookerianum and Hypericum mysorense. The solvent extracts of endophytic fungi isolated from H. hookerianum and H. mysorense were also analysed using GC-MS (Susmita Mondal et al., 2011)

Procedure

The extracts were separated on an Elite-5MS capillary column fitted to a Perkin Elmer Clarus 680 GC was used in the analysis employed a fused silica column, packed with Elite-5MS (5% biphenyl 95% dimethyl polysiloxane, 30 m × 0.25 mm ID × 250μm df) and the components were separated using Helium as carrier gas at a constant flow of 1 ml/min. The injector temperature was set at 260°C during the chromatographic run.  The 1μL of extract sample injected into the instrument the oven temperature was as follows: 60°C (2 min); followed by 300°C at the rate of 10°C min−1; and 300°C, where it was held for 6 min. The mass detector conditions were transfer line temperature 240°C; ion source temperature 240°C; and ionization mode electron impact at 70 eV, a scan time 0.2 sec and scan interval of 0.1 sec. The fragment from 40 to 600Da. Turbo Mass version 5.4.2 software was used for the spectral analysis.

4.5.1 Identification of compounds

Coursework piling up? Get expert help today.

Whether it's weekly coursework, term assignments, or portfolio tasks, our writers understand module-level expectations. We match you with a writer in your subject area who delivers fully referenced, properly formatted coursework on your exact deadline.

✓ Plagiarism-free · ✓ 100% human · ✓ Free revisions · ✓ Confidential

Help With My Coursework

🔒 No payment to start · From 3 hrs

The compounds were identified by interpreting mass spectrum of GC-MS using the database of National Institute Standard and Technology (NIST). The spectrums of the unknown components were compared with the database of spectrum of known components stored in the NIST (2008) library. The molecular weight and structure of the compounds in the test materials were ascertained.

4.6 EVALUATION OF IN VITRO CYTOTOXIC ACTIVITY OF THE PLANTS AND FUNGAL EXTRACTS AGAINST HEp-2 CELL LINE BY MTT ASSAY.

The cytotoxicity activity of the leaves, stem of H. hookerianum and H. mysorense and their fungal extracts were carried out against HEp-2 cell line using MTT assay [(3-(4, 5-dimethylthazol-2-yl)-2, 5-diphenyl tetrazolium bromide) (Mosman, 1983).

Principle

The MTT assay depends on the number of cells present, and on the mitochondrial activity per each cell. The tetrazolium salt MTT was turned into a blue coloured derivative (FORMAZAN) by living cells is clearly a very effective principle on which the assay is based.

4.6.1 Preparation of test samples

10 mg of ethanol, hexane extracts leaves, stem of H. hookerianum and H. mysorense and ethyl acetate, chloroform extracts of fungi isolated from H. hookerianum and H. mysorense, were weighed separately and dissolved in 0.5ml of Dimethyl sulphoxide (DMSO). The volume was made up to 10 ml with maintenance medium (MEM with 2% FBS) to obtain a stock solution of 1 mg/ml concentration, sterilized with Millipore® 0.22 μm, Riviera Cellulose Nitrate Membrane Filter (Catalog No. 754004722) and stored at -20°C. The stock solutions of plants and fungal extracts were diluted with Eagle’s Minimum Essential Medium (MEM) to desired concentrations ranging from 100μg, 50μg, 25μg, 12.5μg, 6.25μg, 3.12μg, 1.56μg/0.1ml. The final concentration of DMSO in each sample did not exceed 0.1% v/v

 

4.6.2 Cell Culture

Human epithelial type 2 (HEp-2) cells were procured from National Centre of Cell Sciences (NCCS, Pune, India). The HEp-2 cell lines were cultured in rectangular canted neck flasks (Fig-4.10) using Eagle’s Minimum Essential Medium (MEM) supplemented with 10% FBS (Fetal Bovine Serum), Earle′s salts, L-glutamine, Sodium bicarbonate, HEPES buffer, Penicillin (100U/ml,), Streptomycin (100μg/ml), and Amphotericin-B (2.5μg/ml). The pH was adjusted to 7.1 to 7.4

4.6.3 Sub culturing of cells

When the HEp-2 cells attained a confluent monolayer (Fig-4.11), separation of the cell line was carried out using TPVG (Trypsin, Phosphate buffered saline, Versene (EDTA) and Glucose) and Phosphate buffered saline (PBS) under room temperature. The medium over the cell line was gently poured out from the culture flask. The confluent cell line was gently washed with 2ml of PBS twice in order to remove the remaining serum from the cell line. 4 ml of TPVG solution was delivered over the cell line, by a micropipette. The flask was incubated at 37ºC in a 5% CO2 atmosphere for 4 minutes until cell line becomes opaque. At this stage cells had undergone rounding without detachment which was observed under Inverted Tissue Culture Microscope. The TPVG solution, applied over the cell line was carefully pipette out from the culture flask. Then 5 ml of 5% MEM growth medium was added into the flask and the content was aspirated several times with a Pasteur pipette in order to suspend and separate the cell line into individual cells.

4.6.4 Cell counting (Haemocytometer)

Cells were counted using haemocytometer. Dilute 0.1 ml of the cell suspension was added in 0.1 ml of trypan blue ( 100 µl cell suspension : 100 µl trypan blue), mixed well and loaded to the haemocytometer using the improved neubauer capillary tube, taking care to avoid overflow. Cells in each of the four corner of the counting chamber were counted under the microscope; Cells in the upper and left border were counted. Dead cells and cells on lower and right border were omitted. The following formula was used for cell counts

      Number of cells counted X dilution factor X 104                                                          Number of squares counted

  Cell/ml =

4.6.5 In vitro cytotoxicity assay by MTT method

0.1 ml of HEp-2 cell suspension was seeded at density of 1.4×105 cell/ml cells to each well of a 96 well microtitre plate (Fig-4.12) and  incubated at 37ºC in a 5% CO2 atmosphere for 24 hrs. Then the medium was removed and 0.1μl of varying concentrations (100μg, 50μg, 25μg, 12.5μg, 6.25μg, 3.12μg, 1.56μg/0.1ml) of each extracts prepared by two fold serial dilutions with 2% MEM were transferred into the respective wells. Further 200μl of 2% MEM was added in to all the experimental wells. 0.1% DMSO added to separate well was taken as negative control and well with positive control Acyclovir [9-(2-hydroxyethoxymethyl) guanosine, were also maintained. The microtitre plate was then incubated at 37ºC atmosphere in a 5% CO2 for 72 hrs (Denis Mabeya Ogato et al., 2015) (Fig-4.13 & 4.14).

4.6.5.1 MTT assay  

Coursework piling up? Get expert help today.

Whether it's weekly coursework, term assignments, or portfolio tasks, our writers understand module-level expectations. We match you with a writer in your subject area who delivers fully referenced, properly formatted coursework on your exact deadline.

✓ Plagiarism-free · ✓ 100% human · ✓ Free revisions · ✓ Confidential

Help With My Coursework

🔒 No payment to start · From 3 hrs

After 72 hrs, the cells were treated with 20 μl MTT (5mg/ml in PBS) and incubated at 37ºC in a 5% CO2 for 4 hrs. The MTT solution was removed without disturbing the Formosan crystals and 150 μl of DMSO was further added in to all the wells and kept at 37ºC for 10 min, where by the crystals were completely dissolved. The plate was read on a microtitre plate reader (Biotek USA) at 540nm. All experiments were performed in triplicate. Cytotoxicity was calculated based on the viability of HEp-2 cell lines using the following formula.

% Cell viability = [O.D of test compound)/ (O.D. of control)] X 100

Concentrations with viable cells and intact cell lines in the experiment were considered as non toxic concentrations and the one detected with morphologically changed cells will not be considered for the antiviral studies. The readings obtained for each extracts were statistically analysed by SPSS software.

Fig- 4.13: Experimental design for in vitro cytotoxicity assay of leaves and stem extracts of Hypericum species in the 96 well plate.

Concentration (µg/0.1ml) Ethanol extracts of leaves and stem Hexane extracts of leaves and stem Acyclovir Cell control
100 Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ
50 Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ
25 Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ
12.5 Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ
6.25 Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ
3.12 Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ
1.56 Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ

Fig- 4.14: Experimental design for in vitro cytotoxicity assay of fungal extracts in the 96 well plate.

Concentration (µg/0.1ml) Ethyl acetate extracts Chloroform extracts Acyclovir Cell control
C.s C.g A.a P.sp A.a C.s C.g A.a P.s A.a
100 Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ
50 Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ
25 Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ
12.5 Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ
6.25 Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ
3.12 Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ
1.56 Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ Օ

4.7 EVALUATION OF IN VITRO ANTIVIRAL ACTIVITY OF THE   PLANTS AND FUNGAL EXTRACTS AGAINST HSV-2 USING HEP-2 CELL LINE BY MTT ASSAY.

4.7.1 Virus stock

HSV-2 (Strain no. 753167) of National Institute of Virology (NIV), Pune, India, was propagated in HEp-2 cell line and incubated at 37ºC for 96 hrs. Complete cytopathic effect virus stock was used for the estimation of TCID50 by end point dilution assay and 10-6.5 TCID50/ml virus stock concentration was used for the antiviral study (Reed and Muench,1938).

4.7.2 Estimation of TCID50 

Preparation of virus dilution

The confluent monolayer of HEp-2 cell line grown in culture flask was used for the estimation of TCID50 assay of HSV-2.

The monolayer of HEp-2 in tissue culture flask was tripsinized. 0.1ml of cell suspension was seeded into 96 well plates with 5% MEM. Thus six vertical rows of seven wells and seventh row of three wells with cell suspension and medium was prepared. The set up was incubated at 37ºC in a 5% CO2 for 24 hrs. When the cells in each well attained confluent monolayer, the growth medium was carefully pipette out and 0.1 ml of 2% MEM was added on the cell line in each well. 0.9 ml of 2% MEM was transferred each of the seven 5 ml sterile glass vial, 0.1 ml of virus stock was added into first vial, tenfold serial dilution was done from first vial to seventh vial (10-1 dilution to 10-7 dilution). New sterile tips were fitted to the micropipette for each dilution step.

0.1 ml of 10-1 dilution was transferred in to each of the six wells of first horizontal row. Horizontal row of 2, 3, 4, 5, 6 and 7 were meant for 0.1 ml of   10-2, 10-3, 10-4, 10-5, 10-6 and 10-7 dilutions. 0.1 ml of 2% MEM alone was transferred into three wells of seventh vertical row for cell control. The entire set up was incubated under 37ºC with 5% CO2 atmosphere for optimum growth of the virus. The microtitre plate wells were observed under inverted tissue culture microscope for development of CPE. The medium in the wells were removed and fresh growth medium was provided on the 4th day and further incubated till complete CPE occurred to the cell line(Fig-4.15). On 7th day, the individual wells in the 96 well plates were score as infected if CPE is more than 2/3 of cells and uninfected less than 2/3 by adopting the method of (Reed and Muench,1938). To calculate the TCID50 by 0.1 ml of virus stock

Fig-4.15: A schematic presentation of TCID50 estimation of HSV-2 in a 96 well microtitre plate

Dilution of virus inoculums 1 2 3 4 5 6 7 8 9 10 11 12
10-1 + + + + + +
10-2 + + + + + +
10-3 + + + + + +
10-4 + + + + + +
10-5 + + + +
10-6 + + +
10-7

+    — Complete CPE

      — Absence of CPE

      — Cell control

After the observation of results based upon CPE the TCID50of HSV-2 was estimated (Fig-4.16).

Table- 4.1: Data on estimation of TCID50 for HSV-2

Coursework piling up? Get expert help today.

Whether it's weekly coursework, term assignments, or portfolio tasks, our writers understand module-level expectations. We match you with a writer in your subject area who delivers fully referenced, properly formatted coursework on your exact deadline.

✓ Plagiarism-free · ✓ 100% human · ✓ Free revisions · ✓ Confidential

Help With My Coursework

🔒 No payment to start · From 3 hrs

Virus concentration Effective cell culture Accumulative of effects
CPE

Need help with your assignment?

Expert writers available now. Original work, no AI, free revisions.

🔒 No payment to start · Free revisions · Money-back guarantee

4.9 ★

Student rating

8,400+

Papers delivered

97%

On-time delivery

Why students choose Scholaris

  • 100% human writing, no AI
  • Plagiarism report with every order
  • Deadlines from 3 hours
  • Money-back guarantee
  • Free unlimited revisions

Related Study Guides