Plants are exploited as a source of food and shelter by a wide range of parasites, including viruses, bacteria, fungi, nematodes, insects and even other plants. They have evolved mechanisms of antimicrobial defence which are either constitutive or inducible. Plants are resistant to most pathogens in their environment, as they are not host plants for particular pathogen or are host plants, but hold on resistance genes, allowing them to recognize specifically distinct pathogen races (Scheel, 1998).
Can I Request a Specific Writer?
Yes, if you have worked with a writer before, you can request them again for consistency and familiarity with your needs. This ensures a smooth, tailored experience. Writer continuity helps maintain consistent style and understanding of your preferences. Browse profiles or contact support to make your choice. Essay writer relationships build over time for increasingly personalized academic support.
The development of resistant crops is one of the important goals of the plant sciences. The total annual worldwide crop losses due to plant diseases are $ 220 million (Agrios, 2005). Plants combat various diseases by physical and chemical barriers and also by the activation of a plethora of defence mechanisms. Plants are attacked by a wide variety of pathogens and to combat these potential infections, plants have evolved four types of resistance: non-host, gene-for-gene, systemic acquired and basal.
1.1. Arabidopsis thaliana:
Resistance is generally associated with the deposition of callose, salicylic acid synthesis and accumulation and pathogenesis related proteins during various plant pathogen interactions. Arabidopsis thaliana has been used as a model plant to study plant pathogen interaction. For example, using this plant, it has been discovered that isochorismate pathway is the major source of SA during systemic acquired resistance. Arabidopsis is a small flowering plant and its whole genome has been sequenced and therefore, scientists currently are using it as model plant to understand different biological phenomena in plants. A large collection of transfer (T)-DNA insertion mutants has also been generated. It is annual plant and has a short life cycle of almost 6 weeks. Different mutants are available for most of the genes in Arabidopsis to study different pathways in various plants.
1.2. Plant Disease Resistance:
Recognition of pathogen and signal transduction is a pre requisite for the activation of plant defence mechanisms. Usually, plants need to use hormones for communication between cells and organs. These hormones modulate the process to start signalling and produce an external effect by a series of chemical reactions. SA fulfils likewise an important role in signalling pathways in plants.
Indisputably, during pathogen and herbivorous attack, plants need to recognize the invader to properly defend themselves against various microbes and insects. The primary defence of plants is formed by prefacing physical or chemical barriers, such as the presence of toxic secondary metabolites. However, if this first line defence fails, plants can activate other defence responses. These include physical barriers, such as the strengthening of cell walls and chemical defences, the production of anti-microbial compounds e.g. phytoalexins. Thus, resistance against microbes can be mediated through defences that are constitutively present, or through defence mechanisms that are induced only after invader attack (Van Loon, 2000; Dicke and Van Poecke, 2002). Induced defences can be highly diversified and administered against various types of pathogens, but their modulation seems to involve only a limited number of plant signalling compounds: salicylic acid (SA), jasmonic acid (JA) and ethylene (ET) (Reymond and Farmer, 1998; Pieterse and Van Loon, 1999; Feys and Parker, 2000; Thomma et al., 2001; Kessler and Baldwin, 2002). Other plant hormones, such as abscisic acid, brassinosteroids, auxins and oxylipins, have been reported to play roles in plant defence against pathogens and also insects. (Jameson, 2000; Farmer et al., 2003; Krishna, 2003; Thaler and Bostock, 2004; Mauch-Mani and Mauch, 2005). Auxin is also an important hormone that affects almost all aspects of plant growth and development and if its homeostasis disturbs, plants can become more susceptible to different pathogens as many pathogens can synthesize auxin-like molecules. Loss of the ability to synthesize auxin-like molecules rendered these pathogens less virulent (Robert-Seilaniantz et al., 2007).
How Do You Ensure On-Time Delivery?
We assign writers immediately and monitor progress, with backup plans to guarantee your paper arrives on schedule. Your deadlines are our priority. Our project tracking system alerts us to potential delays for proactive intervention. Rest assured, we will deliver when you need it. My assignment help includes stringent deadline monitoring for reliable punctual delivery.
1.3. Defence Signaling Pathways:
The signal molecules SA, JA and ET are thought to play key roles in the modulation of plant disease resistance responses. Genetic analyses of mutant and transgenic plants that are affected in the biosynthesis or perception of these compounds have provided enthralling evidence for their role in plant defence against various pathogens. In general, it can be stated that SA-dependent defence is effective against biotrophic pathogens, whereas JA- and ET-dependent defences are important for resistance against necrotrophic pathogens (Dicke and Van Poecke, 2002; Glazebrook, 2005). Pharmacological experiments revealed that exogenous application of these compounds often results in an enhanced level of resistance.
It has formerly been shown that the defence signalling compound SA plays a central role in plant disease resistance, both in the establishment of SAR and the induction of local defence responses in the infected tissue. The central role of this compound in plant defence has been uncovered by the use of transformed plants constitutively expressing the bacterial NahG gene, encoding salicylate hydroxylase, which converts SA into inactive catechol. Tobacco and Arabidopsis NahG plants are unable to accumulate SA and show enhanced disease susceptibility to a broad range of oomycete, fungal, bacterial and viral pathogens (Delaney et al., 1994; Kachroo et al., 2000). Moreover, several recessive Arabidopsis mutants, including eds5, sid2 and pad4, do not show SA accumulation upon pathogen infection.
After pathogen attack and rendering effective resistance against the invader, plants develop an enhanced defensive capacity against further attack. An induced systemic resistance mechanism against pathogens has been well explored: pathogen-induced systemic acquired resistance (SAR) (Ross, 1961).
1.4. Systemic acquired resistance (SAR):
Systemic acquired resistance (SAR) is a mechanism which is induced after pathogen attack and it provides long-term protection against a broad spectrum of pathogens. SAR requires the signal molecule salicylic acid (SA) and it is associated with the accumulation of pathogenesis related proteins. It pertains to an explicit signal transduction pathway that plays an important role in making plants resistant against different pathogens. In SAR, after the formation of a necrotic lesion, either as a part of the hypersensitive response (HR) or as a symptom of disease, the SAR pathway is activated. SAR activation results in the development of a broad-spectrum, systemic resistance (Hunt and Ryals, 1996; Neuenschwander et al., 1996). SAR is associated with the expression of a set of genes called SAR related genes (defence genes) (Ward et al., 1991). When SAR is activated, it decreases the severity of an incompatible response.
Can You Help with Reflective Essays?
Our writers craft thoughtful reflective essays, blending personal insight with academic structure to meet your goals. We capture your voice perfectly. Reflective writing requires balancing personal experience with scholarly analysis. Share your story or guidelines to get started. Research study bay professionals excel at combining personal narrative with academic rigor.
1.7. Salicylic Acid and SAR:
Salicylic acid is an important signaling pathway in plant diseases. Its accumulation is required at the site of attack for the activation of systemic acquired resistance. NPR1 (nonexpressor of pathogenesis-related (PR) genes 1) is a SA responsive coactivator. In plants, oxidative thiol modifications were shown to play an important role in modulating the activity of the immune coactivator NPR1 (Dong, 2004). NPR1 functions as a global regulator of defence gene expression. In plant cells, before pathogen attack, conserved cysteines in NPR1 form intermolecular disulphide bonds, resulting in the formation of a cytosolic NPR1 oligomer (Mou et al., 2003). This makes NPR1 transcriptionally inactive as it is excluded from the nucleus and after pathogen attack, SA-mediated redox changes convert NPR1 from oligomer to monomer and it is translocated to the nucleus where it binds to TGA transcription factors and activates pathogenesis related gene expression. Intermolecular disulphide bonds in TGA1 and TGA4 that prevent interaction with NPR1 are disrupted upon SA-induced cellular reduction, allowing these TGAs to form a transcriptionally active complex with NPR1 in the nucleus (Despres et al., 2003). Therefore, it has been identified that NPR1 acts downstream of SA. A low level of S-nitrosylaton increases NPR1 in monomeric form. It also blocks SA accumulation. Consequently, when S-nitrosylation is high, plants become more susceptible to diseases and other stresses.
SA is synthesized by plants in response to challenge by a diverse range of plant pathogens and is essential to the establishment of both local and systemic-acquired resistance as its application induces accumulation of pathogenesis-related (PR) proteins and mutations leading to either reduced SA production or impaired SA perception enhance susceptibility to avirulent and virulent pathogens (Loake and Grant, 2007).
There are two pathways for SA biosynthesis: one is through an enzyme isochorismate synthase and the other is through phenylalanine.
1.5. Nitric Oxide (NO) and Plant Disease Resistance:
Nitric Oxide is an important signaling molecule in plant disease resistance. If we stop NO production or we remove it from the plants, we can compromise disease resistance. Simple structure, high diffusivity and the presence of an unpaired electron make (NO) an ideal signaling molecule within species from every biological kingdom (Arasimowicz and Floryszak-Wieczorek, 2007; Hong et al., 2007). The initiative to uncover various roles of NO in plants is a recent one while its importance in animal biology like in respiration, apoptosis, gene expression, cell motility and blood flow etc. was recognized quite early. NO plays an important role in many cellular processes of plants like respiration, programmed cell death, seed germination, flowering and stomatal closure (Neill et al., 2007). Unlike NO synthases (NOS), which is primarily responsible for NO production in animals, plants have a more complex mechanism of NO production. In plants, nitrate reductase (NR) enzyme which convert nitrate into nitrite and also nitrite into NO is one possible source of NO. An enzyme having NOS like activity in Arabidopsis AtNOS has been found (Crawford, 2006). A T-DNA knockout of this gene showed reduce growth and increased susceptibility against Pst DC 3000. However, ATNOS1 has been shown not to directly produce NO. Therefore, the name of this protein has been changed to Arabidopsis thaliana Nitric Oxide Associated 1(AtNOA1) is proposed (Grennan, 2007).
A key feature of R-mediated resistance is the production of reactive oxygen species (ROS) and the hypersensitive reaction (HR). NO reacts with superoxide (O-) to produce peroxynitrite (ONOO-) (Clarke et al., 2000; Zaninotto et al., 2006). The balanced production of NO and H2O2 during attempted pathogen infection triggers cell death (Wendehenne et al., 2004). HR not only deprives the pathogen of nutrients but also results in the accumulation of SA. Increased SA levels in response to pathogen infection activate PR proteins (markers for the long lasting SAR in the distal tissue against secondary infection). Plants do not have any structural homologues of animal caspases. However, an overexpressor of protease inhibitors like cystain in plants also diminished cell death in plants (Hong, et al, 2007). Interestingly there are number of systems where NO even acts as protectant against ROS (Squadrito and Pryor, 1995). NO also plays a vital role in abiotic stresses and its exogenous application improves plants tolerance against drought and cold (Siddiqui et al, 2010). Moreover, exposure to low levels of NO helps in reducing the destructive effects of heavy metals. (Arasimowicz and Floryszak-Wieczorek, 2007). In 1992, the biological significance of NO was recognized by SCIENCE which named the free radical NO as “Molecule of the Year” (Koshland 1992).
What Is Your Quality Control Process?
Every paper is reviewed by editors for accuracy, style, and originality, ensuring it meets high academic standards. We use advanced tools to guarantee quality. Our multi-tiered review system includes both automated checks and expert human evaluation. Your paper will exceed expectations every time. Paper writing quality assurance involves multiple verification stages before delivery.
1.6. Role of S-Nitrosylation in Plant Disease Resistance:
S-nitrosylation, a key redox based post translational modification plays an important role in plant disease resistance (Feechan et al., 2005). S-nitrosylation, the covalent attachment of a nitrogen monoxide group to the thiol side chain of cysteine plays an important role in signal transduction pathways (Hess, 2005). This process can modify protein activity, protein localization and protein-protein interaction. The role of specific enzymes in S-Nitrosylation is not discovered but NO sources used for S-nitrosylation are free NO, small-molecule NO donors, peroxynitrite, nitrite and metal NO complexes (Wang et al., 2006). The reaction of NO with an antioxidant glutathione (GSH) results in the formation of S-nitrosoglutathione (GSNO) which acts as mobile reservoir of NO bioactivity (Feechan, 2005). GSH is an important reducing agent in plants which shows tolerance to environmental stresses. Biotin switch technology helped in the identification of S-nitrosylated proteins from cell culture and leaves of Arabidopsis when treated with the NO donor GSNO (Lindermayr, 2005). Proteins involved in stress, metabolism, signaling, redox-regulation and the cyto-skeleton association in plants is found to be S-nitrosylated by biotin switch technology in plants. Among these metabolic enzymes involved in glycolysis and sulphur metabolism, enzymes are also potential targets of S-nitrosylation (Grennan, 2007). An enzyme, formaldehyde dehydrogenase (GS-FDH) isolated from E.coli which exhibits strong reductase activity is involved in GSNO turnover. In plants, an enzyme, S-nitrosoglutathione reductase regulates global S-nitrosylation. It is a key player is plant disease resistance. This enzyme in Arabidopsis thaliana, AtGSNOR1 negatively regulates S-nitrosylation. Elevated levels of S-nitrothiols (SNOs) are found in a T-DNA knock out mutant (atgsnor1-3) as compare to wild type. Furthermore, an over expresser mutant (atgsnor1-1) plants has reduced SNO levels. Accumulation of S-nitrothiols is associated with susceptibility, as the atgsnor1-3 mutant was compromised in all forms of resistance. Molecular analysis revealed that increased S-nitrosylation result in the reduction of both SA biosynthesis and signalling (Feechan, 2005; Arasimowicz and Floryszak-Wieczorek, 2007). Furthermore, S-nitrosylation of SA binding protein (SABP) 3 resulted in inhibition of carbonic anhydrase (CA) activity and ultimately compromised R-gene mediated resistance (Wang et al., 2006).
Two reducing systems, consisting of GSNOR and thioredoxins have been identified so far which play important role in the regulation of S-nitrosylation. GSNOR indirectly regulates S-nitrosylation. Mutations in AtGSNOR1 modulate the level of S-nitrosylation (Feechan et al., 2005). A loss of function mutant, atgsnor1-3 increases global S-nitrosylation while a mutation that results in over-expression of AtGSNOR1 leads to reduced global S-nitrosylation.
1.8. Thioredoxins:
In plants, there are certain enzymatic pathways which remove the oxidative thiol modifications. One reducing system, consisting of thioredoxin (TRX) and thioredoxin reductase, has attracted particular attention because of its involvement in many disorders and diseases. Thioredoxin (TRX) is a small (12kDa), multifunctional protein with a redox active dithiol/disulfide site sequence and maintains cellular redox homeostasis. S-nitrosylation of NPR1 by S-nitrosoglutathione (GSNO) at cysteine-156 facilitates its oligomerization and it is sequestered in the cytoplasm as an oligomer through intermolecular disulfide bonds and this SA-induced NPR1 oligomer-to-monomer reaction is catalyzed by thioredoxins (TRXs) (Tada et al., 2008). Particularly, cytosolic TRXs in plants were shown to be required for the SA-induced reduction of the NPR1 coactivator from oligomer to active monomer (Tada et al., 2008). TRX5 is involved in systemic acquired resistance and in effector triggered immunity and it is highly pathogen inducible. Mutations in both NPR1 and TRX compromise NPR1-mediated disease resistance. Thioredoxins cause reduction in the nucleus by causing reduction in the intermolecular disulphide bonds. After causing this reduction, they themselves become deactivated. Then thioredoxin reductase reactivates them by using the reducing power of NADPH. In their reduced state, thioredoxins are able to provide reducing power to numerous target proteins like peroxidases or reductases (carmel-Harel and Storz, 2000; Nordberg and Arner, 2001).
Figure 1. Biochemical mechanisms of protein denitrosylation.
(a) Mechanisms of denitrosylation by thioredoxin (Trx) and S-nitrosoglutathione reductase (GSNOR). (b) Alternative proposed mechanisms of Trx-mediated denitrosylation.
Can You Include Specific Sources?
Yes, provide your sources or let our writers find credible ones, properly cited to support your paper. Every source is cited perfectly. We integrate your required readings seamlessly while maintaining academic citation standards. Share your materials in the order form for best results. Assignment writer expertise ensures proper source integration and citation accuracy.
Thioredoxins perform the following functions:
- Denitrosylation
- Regulation and
- Reduction.
Thioredoxins themselves become S-nitrosylated and cause denitrosylation of the target proteins using the reducing power of NADPH (Fig.1). Therefore they play an important role in defence. Thioredoxins and GSNOR have the same outcome i.e. they denitrosylate the targeted proteins but GSNOR causes this denitrosylation indirectly and thioredoxins do this more directly.
1.9. Nuclear thioredoxins:
In yeast, nuclear thioredoxin was shown to inactivate the Yap1 transcription factor by reducing its intermolecular disulphide bond, resulting in nuclear export (Izawa et al., 1999). In plants, nuclear thioredoxin 1 and 2 have been identified. Thioredoxins function in their reductive phases, defence proteins such as NPR1 appears to activate target genes (PR genes) only during the reductive phases (Mou et al., 2003; Tada et al., 2008; Spoel et al., 2009) and reduction always occurs in the nucleus. Transcription factors start binding with DNA in the nucleus in the reducing state. We can say that every process in the nucleus occurs when reducing state prevails. That’s why scientists, currently are paying particular attention towards nuclear thioredoxins. As they are included in thioredoxin family, they perform the same functions as thioredoxins.
Aims and Objectives:
- How does GSNO reduce SA level after pathogen infection?
We will check the expression of genes integral to SA biosynthesis including; ICS1, EDS5, PAD4 and PBS3 in different mutants, gsnor1-1 and gsnor1-3 which are dysregulated in the biosynthesis of this molecule. Global S-nitrosylation levels are decreased in gsnor1-1 but increased in gsnor1-3 in SA biosynthesis. It is now well established that increased s-nitrosylation blocks SA accumulation. However, the underlying mechanism remains to be determined.
Can You Write for Professional Programs?
We create papers for MBA, law, or medical programs, with writers who understand their unique requirements. Our expertise ensures top-quality results. Professional programs demand industry-specific knowledge and specialized writing conventions. Provide your program details for a customized paper. Ace tutors with professional credentials deliver field-appropriate academic writing.
There could be several hypotheses for why SA accumulation is low in the presence of high levels of S-nitrosylation: (1) S-nitrosylation might suppress the above mentioned genes that encode the enzymes for SA synthesis; (2) S-nitrosylation could increase the mRNA turnover of genes encoding enzymes of SA synthesis; SA is synthesized but it turns over quickly and One or more enzymes of SA biosynthesis are post translationally modified, blunting their activity in the biosynthesis of this molecule.
First it will need to design the primers of above mentioned genes and then check their expression through RT-PCR.
A mutant (nrx1) has been made using T-DNA insertion in NRX1 (Nucleoredoxin1) to see its role in defence. So we will see what is the interaction between nrx1 and gsnor1-3 and what role do they play in disease signaling? As we know that nrx1 mutant has low levels of S-nitrosylation but gsnor1-3 mutant has high levels of S-nitrosylation. So we will make a double mutant (gsnor1-3 X nrx1) to see whether they play role in the same signaling pathway or not. We will also cross nrx1 mutant with pad4, sid2, NahG and gsnor1-3 to further confirm the role of nrx1 mutant in defence.
We will also treat nrx1 mutant with hormones like SA, jasmonic acid, auxin and ACC to further identify its role in any other signaling pathway.
How Do You Handle Complex Formatting?
We follow any formatting rules, from specific fonts to citation styles, ensuring your paper meets all guidelines. Precision is our promise. Complex formatting includes margin specifications, heading hierarchies, and style guide compliance. Provide your formatting details for flawless execution. Research essay service attention to detail covers every formatting requirement precisely.
Nuclear thioredoxins play role in the regulation of S-nitrosylation. It has been found that animal thioredoxins can remove S-nitrosylation then most probably plant nuclear thioredoxins may also have role in denitrosylation.
A mutant in nuclear thioredoxin may look like gsnor mutant. If they are involved in denitrosylation, then mutating both of them may cause higher S-nitrosylation. We will do this through infection experiments, gene expression and expression of thioredoxin itself by using different thioredoxin mutants such as nrx1 and nrx2. In the later stages, we would also find how many proteins are S-nitrosylated in these mutants. We will test all the mutants by looking pathogen growth and gene expression.
Part II. Materials and Methods
All chemicals were purchased from Sigma (Sigma-Aldrich, UK)
2.1. Materials:
2.1.1. Bacteria:
Pseudomonas syringae pv tomato strain DC 3000 (Whalen et al., 1991)
Are Your Writers Field Experts?
Our writers hold degrees in their fields, ensuring deep knowledge and precise handling of specialized topics. This guarantees a high-quality, tailored paper. Subject expertise ensures accurate terminology and current understanding of field developments. Trust us to match you with the right expert. Essay helper specialists bring authentic subject mastery to every assignment.
Psudomonas syringae pv maculicola strain ES4326.
2.1.2. Plant Material and Growth conditions:
Arabidopsis plants, loss of function mutant atgsnor 1-3, npr1 and gain of function mutant atgsnor1-1(24-2 and 24-34) along with some thioredoxin mutants (nrx1, nrx2,) of Col-0 background were grown as six per pot at 20° C in a pathogen free chambers under long day conditions (16 light/8h darkness).The potting medium consists of peat moss, vermiculite and sand with 4:1:1 respectively.
2.1.3. Media and Additives:
2.1.3.1. Bacterial Media:
2.1.3.2. KB Medium:
Protease peptone 20g/l, glycerol 10ml/l, K2HPO4 1.5g/l, agar 15g/l, when cool, add 1M MgSO4 5ml/l.
2.1.3.3 Antibiotics:
Kanamycin (1000x): 50 mg/ml in H2O
Can You Help with Policy Briefs?
We craft concise, persuasive policy briefs, backed by research and tailored to influence your audience. Our writers deliver impactful arguments. Policy briefs require strategic framing and evidence-based recommendations for decision-makers. Provide your topic for a compelling brief. Ace my homework extends to professional policy writing for public administration courses.
Rifampicin (1000x): 100mg/ml in DMSO
Stock solution stored at -20° C
2.1.4. Bacterial liquid culture for pathogenicity assay:
Following procedure used to make bacterial culture and to inoculate plants:
Procedure:
What Is Your Revision Turnaround?
Revisions are completed within 24 to 48 hours, with rush options to meet urgent deadlines without delay. We act fast to keep your paper on track. Our efficient revision process prioritizes quick turnaround while maintaining quality standards. Submit your revision requests through your account for quick results. My assignment help includes rapid revision services for time-sensitive adjustments.
Pick a relatively generous amount of inoculum of the chosen bacterial strain from the stock plate and inoculate 5ml of King’s broth (KB) medium. Incubate overnight at 28° C. Room temperature will be sufficient if incubator is not available. (The inoculum should be generous, as Pseudomonas syringae does not grow as fast as E. coli, and the culture should be quite dense after overnight incubation (OD 600=1.0 or higher)). In my experiments, I used OD 600= 0.02-0.0002.
The following day, pallet the cells and resuspend them in an appropriate volume of 10mM MgSO4. (Adjust the concentration of the bacterial suspension according to the purpose of the experiment and inoculation techniques used).
Use the following method to inoculate plants.
Draw the bacterial suspension into a 1cc syringe and use it to force the suspension on the abaxial surface of the leaf.
Can You Write for Online Courses?
We handle assignments for online courses, adapting to digital formats and specific platform requirements. Our writers ensure seamless integration with your course. Online course assignments often have unique submission formats and discussion requirements. Upload your assignment details to get started. Paper writing for online education accommodates various learning management systems.
Hold the index finger of one hand against the adaxial surface of the leaf, use the other hand to press the syringe against the abaxial side at the corresponding position, and depress the plunger.
2.1.4.1. Pathogenicity susceptibility Assay (EDS):
Pseudomonas syringae pv maculicola strain ES4326 was grown in KB medium supplemented with 100mg/l streptomycin and incubated in the 28 degree shaker for 24 hours. Four weeks old plants (col-0, nrx1, nrx2 and npr1) were infected with a Psm ES4326 suspension (OD 600= 0.0002) in 10mM MgSO4 on the abaxial side of the leaf using a 1ml syringe (Cao et al., 1994). Three leaves per plant and three plants per line were infected. After five days, plants were examined for disease symptoms by counting the colonies formed by the pathogen.
2.1.4.2. Pathogenicity Resistance Assay (SA induced resistance):
Pseudomonas syringae pv maculicola strain ES4326 was grown in KB medium supplemented with 100mg/l streptomycin and incubated in the 28 degree shaker for 24 hours. Four weeks old col-0, nrx1, nrx2 and npr1 were sprayed with 0.5mM SA solution and water (as control). Plants were also infected with Psm ES4326 suspension (OD 600= 0.002) after 2 days using the same procedure as mentioned above and were examined for disease symptoms 3 days of post inoculation through colony count method.
Molecular work:
Pseudomonas syringae pv tomato DC3000 (Whalen et al., 1991) was grown in KB medium supplemented with 50mg/l rifampicin. Four weeks old plants were infected with a Pst DC3000 suspension (OD 600= 0.02) in 10mM MgSO4 on the abaxial side of the leaf using a 1ml syringe (Cao et al., 1994). Three leaves per plant and three plants per line were infected by using different time points. Then plants were also infiltrated with the same pathogen but with lower OD 600= 0.0002 at different time course. After the specific time course, tissues were collected in the liquid nitrogen and were kept at -80° C. then their RNA was extracted and normal RT PCR was done to check the expression of target genes.
How Do You Protect My Data?
Your personal and order details are encrypted and never shared, ensuring total privacy and security. We prioritize your confidentiality at every step. Bank-level encryption protects all transmitted data from unauthorized access. Your information is safe with us. Assessment help security protocols safeguard all student information comprehensively.
2.1.5. Nucleic Acid Related Methods:
2.1.5.1. DNA Isolation:
100mg plant material was ground in C-TAB extraction buffer for DNA isolation and transferred into 1.5 ml microfuge tube. Extract was incubated at 65°C for at least 30 mins. 300μl of Chloroform was added and mixed by inverting the tube. The samples were centrifuged at 15000rpm for 2 minutes. Supernatant was transferred to a new Eppendorf tube containing equal volume (300μl) isopropanol. The samples were thoroughly mixed and centrifuged at15000rpm for 5 minutes. Supernatant was discarded and pellet was washed with 70% ice cold ethanol and centrifuged at 15000rpm for 2 mins. Finally dry pellet was re-suspended in 100μl H2O or TE Buffer.
2.1.5.2. RNA Extraction:
RNeasy Plant Mini Kit (QIAGEN) was used to extract RNA. Its procedure is as follows:
Plant tissues collected in liquid nitrogen were ground first and then almost 100mg powder was added in 1.5ml microcentrifuge tube containing 450μl RLT buffer along with 10μl mercaptoethanol and was mixed thoroughly. The tissue was incubated at 56°C for 1-3minutes. The lysate was then transferred to a QIAshredder spin column (lilac) placed in 2ml collection tube and centrifuged for 2min at full speed. Supernatant was carefully transferred to an RNeasy spin column (pink) placed in 2ml collection tube supplied in kit. Then 0.5 volume of 100% ethanol was added in the cleared lysate and mixed immediately by pipetting and centrifugation done for 15seconds at full speed. The flow through was discarded after centrifugation. 700μl RW1 buffer was added in RNeasy spin column and again centrifugation done for 15seconds at full speed and flow through was discarded. 500μl buffer RPE was added in the column and centrifugation done for 15 seconds at full speed. RPE buffer was again added in the column after discarding the flow through but this time centrifugation was done for 2min at full speed to wash the spin column membrane. As the long centrifugation dries the spin column membrane, ensuring that no ethanol is carried over during RNA elusion. Residual ethanol may interfere with downstream reactions. After centrifugation RNeasy spin column was carefully removed from the collection tube so that column did not contact the flow through. Otherwise carryover of ethanol would occur. Then the RNeasy spin column was placed in a new 2ml collection tube supplied in the kit and the flow through was discarded along with the old collection tube and centrifugation was done at full speed for 1min. RNeasy spin column was then placed in a new 1.5ml collection tube (supplied) 30-50μl RNase free water was directly added in the spin column and centrifugation done for 1min at full speed. RNA concentration was finally measured using nanodrop.
2.1.5.3. cDNA Synthesis:
Table 1. Recipe for cDNA synthesis.
cDNA reagents Concentration Volume
Can You Help with Critical Analyses?
Our writers produce sharp critical analyses, evaluating sources and arguments with academic precision. We bring clarity to complex ideas. Critical analysis requires both comprehension and evaluation of underlying assumptions. Share your topic for an insightful analysis. Research study bay expertise delivers sophisticated critical thinking in every analysis.
Buffer (10x) 10x 2 µl
dNTPs 5 mM 2 µl
Oligo DT 25µM 0.8µl
RNase inhibitor 0.25µl
What Is Your Availability for Support?
<>
Our support team is here 24/7 via chat, email, or phone, ready to help with any order concerns. We are committed to your success. Multiple communication channels ensure you can reach us through your preferred method. Reach out anytime for assistance! Essay writer support connects you with help whenever questions arise.
Omniscript RT 1µl
Total 6.05µl
Omniscript RT (QIAgen) kit was used to synthesize cDNA. First of all RNA was denatured at 65° C for 10 minutes. Then master mix containing the above reagents was added in the denatured RNA along with the measured quantity of water and the reaction mixture was incubated first at 37°C for 1 hour and then at 72°C for 5 minutes.
2.1.5.4. Primer Designing:
Following primers were used to check the expression of defence genes in different genomes. Table 2. Primers used for genetic analysis with their name and sequence.
genoppID
Can You Handle Mixed-Method Research?
We combine qualitative and quantitative methods in research papers, delivering balanced, rigorous results. Our writers ensure depth and accuracy. Mixed-method approaches require expertise in both statistical analysis and qualitative interpretation. Provide your research needs for a tailored paper. Assignment writer proficiency spans diverse research methodologies for comprehensive studies.
Size
Forward sequence
Reverse sequence
Tm
1-ICS1/SID2
At1g74710.1f235r400
703
GGTGCACCAGCTTTTATCGGAAAC
Do You Offer Free Revisions?
Yes, free revisions are available within 7 days to ensure your paper meets all your expectations. We are here to make it perfect. Our revision policy covers both minor adjustments and substantial changes as needed. Submit your feedback through your account. Ace tutors remain committed to revision support until complete satisfaction.
TGAGAACCCCTTATCCCCCATACAA
64/64
2- EDS5/SID1
At4g39030.1f35r232
410
CTGCGTCAGAATTGATCGGGAA
CAGCCCAAGGACCGAATAATCTTG
Can You Create Detailed Outlines?
Our outlines include structure, arguments, and sources, providing a clear plan for your papers success. They keep your project focused and organized. Comprehensive outlines serve as blueprints that guide the writing process effectively. Request an outline with your order. Research essay service planning includes thorough outlining for organized writing.
63/63
3- PAD4
At3g52430.1f91r442
567
ATGACATCGCCGGGATTACATACG
GATGTTCCTCGGTGTTTTGAGTTGC
64/64
4- PBS3
At5g13320.1f244r294
737
Can You Write for Interdisciplinary Fields?
Our writers blend expertise across fields, crafting cohesive papers for complex, cross-disciplinary topics. We ensure every angle is covered. Interdisciplinary work requires synthesizing different methodological approaches and theoretical frameworks. Share your topic for a tailored approach. Essay helper versatility covers interdisciplinary subjects with integrated perspectives.
CGACTTGCCTCTCGTTTCAACAAC
GCAAGGCTTTCCCTGACTTAATGC
64/64
5- NRX1
At1g60420.1f157r613
328
TTCTCGGCCCTGATGGAAAAACC
GCTTCATTCCGCTCCTTTATCTGCT
65/65
6- NRX2
At4g31240.1f146r23
410
How Do You Support International Students?
We tailor papers to your academic system and language needs, ensuring clarity for international students. Our writers make academic work accessible. International students benefit from our understanding of diverse educational systems and conventions. Let us know your needs for a perfect fit. Paper writing support accommodates global students with culturally sensitive academic assistance.
CACGAGTCCCGAAATTACGTTGTTG
TCCGTGAACGGAAAACTCCTTGA
64/64
2.1.5.5. Normal Reverse Transcriptase PCR (RT-PCR):
The cDNA obtained from col-0, fdh1-1(24-2, 24-34), fdh/gsnor1-3, nrx1, nrx2, nrx1/2 and npr1 were used as template in PCR amplification using primers given in Table 2.
Can You Meet Custom Deadlines?
We work with your specific deadlines, prioritizing tasks to deliver quality papers exactly when you need them. Your schedule is our priority. Flexible deadline options accommodate both standard and non-standard timeframes. Specify your deadline in the order form. My assignment help scheduling flexibility ensures delivery aligned with your academic calendar.
PCR reagent Concentration Volume
Template 1 µl
dNTPs 2.5 mM 2 µl
Buffer 10x 2.5 µl
MgCl2 25 mM 2.5 µl
Forward primer 10µM 1 µl
What Is Progressive Delivery and How Does It Work?
Progressive delivery is ideal for large projects like dissertations, delivering your paper in sections for review. Pay in installments and provide feedback per part, ensuring alignment with your vision for just a 10% fee. This gives you more control and collaboration with your writer. Staged delivery reduces stress and allows for course corrections throughout the project. Ace my homework large projects benefit from phased delivery with ongoing feedback opportunities.
Reverse primer 10µM 1 µl
Taq Polymerase (Home made) 5 U 0.5 µl
Double distilled H2O 14.5 µl
Total Volume 25 µl
I Received Some Comments from My Teacher. Can You Help Me with Them?
Absolutely! Share your teachers feedback, and within 7 days of receiving your paper, request a free revision via your account. If you want a different writer, we can arrange that with a small delay. Beyond 7 days, paid revisions are available—check your order page for details. We incorporate instructor feedback to ensure your paper meets specific expectations. Assessment help includes responsive revision services addressing professor comments directly.
Table 4. PCR Profile.
- Initial denaturing temperature 94°C 1 minutes
- Denaturing temperature 94°C 30 seconds
- Annealing temperature 54-62°C 30 seconds
- Extension temperature 72°C 30 seconds
- 25-30 cycles from step 2 to step 4
- Final extension temperature 72°C 7 minutes
- 4°C forever
The amplified products were analyzed by electrophoresis on 1.2% agarose gel along with 100bp DNA ladder.
2.1.5.6. Normal Reverse Transcriptase PCR (RT-PCR) with Crimson Taq:
Table 5. Recipe for normal RT-PCR with crimson taq.
PCR reagent Concentration Volume
Template 1 µl
dNTPs 2.5 mM 2 µl
Do You Offer Referral Discounts?
Refer a friend, and you both get 5% off your next order—a win-win for sharing our services! It is our way of saying thank you for spreading the word. Our referral program rewards you for recommending quality academic support to peers. Check your account for referral details. Research study bay referral benefits make quality academic support more affordable for everyone.
Crimson Taq Buffer 5x 5 µl
Forward primer 10µM 1 µl
Reverse primer 10µM 1 µl
Crimson Taq Polymerase 0.125 µl
Double distilled H2O 14.875 µl
Total Volume 25 µl
Table 6. PCR Profile for Crimson Taq.
- Initial denaturing temperature 95°C 30 seconds
- Denaturing temperature 95°C 30 seconds
- Annealing temperature 54-62°C 30 seconds
- Extension temperature 68°C 30 seconds
- 25-30 cycles from step 2 to step 4
- Final extension temperature 68°C 5 minutes
- 4°C forever
The amplified products were analyzed by electrophoresis on 1.2% agarose gel along with 100bp DNA ladder.
Part III. Results and Discussion
Results
3.1.1 SA synthesis gene expression analysis in gsnor1-1 and 1-3 mutants:
Wild type Col-0, gsnor1-1 and gsnor1-3 mutants were treated with Pseudomonas syringae pv tomato strain DC3000 (Pst DC3000) through pressure infiltration at OD600= 0.02. RT-PCR was performed on the samples to check the expression of SA synthesis genes by using primers of all the genes like ICS1, EDS5, PAD4, and PBS3. PR1 primer was used as negative control. According to the results, there was strong induction of all the genes beca